当前位置:首页 期刊杂志

Ionomycin ameliorateshypophosphatasia via rescuing alkaline phosphatase de ficie

时间:2025-01-07

Bei Li,Xiaoning He,Zhiwei Dong,Kun Xuan,Wei Sun,Li Gao,Shiyu Liu,Wenjia Liu,Chenghu Hu,Yimin Zhao,Songtao Shi and Yan Jin

INTRODUCTION

A loss-of-function mutation in the liver/bone/kidney alkaline phosphatase(ALPL)gene results in the life-threatening disease hypophosphatasia(HPP)during early developmental periods;HPP is characterized by hypomineralization of the skeleton and teeth.1–2Adult patients with HPP showed early loss of primary or secondary teeth,osteoporosis,bone pain,chondrocalcinosis,and fractures.Our previous study found age-related bone mass loss and marrow fat gain in heterozygousAlpl+/-mice.3Bone marrow mesenchymal stem cells(BMSCs)are multipotent cells capable of differentiating into various cell lineages,including osteoblasts and adipocytes.As age increases,BMSCs are more inclined to undergo differentiation into adipocytes rather than osteoblasts,resulting in an increased number of adipocytes and a decreased number of osteoblasts,which leads to osteoporosis.4Our previous study also showed that ALPL governed the osteoadipogenic balance in BMSCs and prevented cell senescence.3ALPL is a ubiquitous plasma membrane-bound enzyme(ectoenzyme)that functions at physiological(neutral)and alkaline p H to hydrolyze several different molecules,including inorganic pyrophosphate,5pyridoxal-5-phosphate (the active form of vitamin B6),6and nucleotides.7–9However,the detailed mechanism of ALPL causing age-related osteoporosis is largely unknown.

In severely affected infants with HPP,hypercalcemia,and hypercalciuria are often reported as symptoms.10–11However,it is still not clear why calcium metabolism abnormalities are induced by an ALPLmutation,since ALPLplays an important role in generating inorganic phosphate.Meanwhile,whether aberrant calcium metabolism is involved in age-related osteoporosis in heterozygousAlpl+/-mice is also unclear.It is well accepted that calcium metabolism abnormalities are closely related to calcium channels on the cell surface.Calcium in flux is controlled by voltage-gated Ca2+channels(VGCCs)or agonist-dependent and voltage-independent Ca2+entry pathways,which are called‘storeoperated’Ca2+channels(SOCs).Changes in intracellular Ca2+concentration([Ca2+]i)play an essential role in regulating motility,apoptosis,differentiation,and many other cellular processes.12Aberrant intracellular[Ca2+]ileadsto the lossof Ca2+homeostasis,which causes abnormal calcium metabolism and bone disorders.13–14Several types of Ca2+channels are reported to regulate intracellular Ca2+homeostasis in BMSCs and osteoblasts to affect bone repair.15–17Thus,the regulation of Ca2+channels at the membrane plays a central role in BMSC function and in bonerelated diseases.However,whether ALPL modulates Ca2+channels to maintain Ca2+homeostasis in BMSCs is unknown.

Currently,speci fic medical treatment optionsfor HPPare limited to bone-targeted enzyme replacement therapies(asfotase,Strensiq,and Alexion),which have been approved for pediatric-onset HPP.18–19At this time,there are no guidelines for selecting adult patients for treatment,evaluating the results of treatment,or determining the optimal duration of treatment.In this study,we used human and mouse models to demonstrate that ALPL is required for the maintenance of intracellular Ca2+in flux because it regulates L-type Ca2+channel traf ficking via binding to the α2δ subunits,which regulate the internalization of L-type Ca2+channels.This decreased Ca2+flux downregulates Akt/GSK3β-mediated Wnt/β-catenin signaling in BMSCs,leading to an age-related osteoporotic phenotype.Moreover,we found that raising the intracellular level of calcium in BMSCs by treatment with ionomycin rescues the osteoporotic phenotype inalpl+/-mice and BMSC-speci fic(Prrx1-alpl-/-)conditionalalplknockout mice,and the treatment restores stem cell function of BMSCs from HPPpatients,suggesting a new strategy for HPPtherapy.

RESULTS

ALPLde ficiency caused decreased membrane expression of L-type Ca2+channels in BMSCs

Patients with severe ALPL de ficiency develop hypercalcemia,10–11so we examined the plasma calcium level inalpl+/-mice and found a marked increase in the level of plasma calcium(Fig.S1a).To explore whether ALPL de ficiency contributes to abnormal calcium metabolism in BMSCs,we isolated BMSCs fromalpl+/-mice(Fig.S1b–e)and examined cytosolic Ca2+.We found that introducing a lentivirus that overexpressed ALPL(Fig.S2a)intoalpl+/-BMSCs was able to increase the cytosolic Ca2+ofalpl+/-BMSCs(Fig.S2b).Ca2+entry across the plasma membrane occurs via two distinct kinds of channels,SOCs,and VGCCs.To test which type of Ca2+channels might be affected in the absence of ALPL,WT,andalpl+/-BMSCs were cultured with 10 nmol·L-1thapsigargin(TG).TGisa noncompetitive inhibitor capable of raising the cytosolic Ca2+concentration via blocking the ability of the cell to pump Ca2+into the sarcoplasmic and endoplasmic reticula to activate plasma membrane Ca2+channels.No signi ficant differences were evident in TG-induced intracellular Ca2+in flux that were detected in WT,alpl+/-,and shALP-treated BMSCs(Fig.S2c,d).These data suggest that ALPLde ficiency affects VGCCfunction in BMSCs.The contribution of ALPL to the function of VGCCs in BMSCs was determined after membrane depolarization using 30 mmol·L-1KCl.Intracellular Ca2+imaging analysis showed that KCl-induced Ca2+in flux was signi ficantly decreased in cultureexpandedalpl+/-and shALP-treated BMSCs compared with that of WT BMSCs(Fig.1a).Moreover,intracellular Ca2+imaging analysis showed that KCl-induced Ca2+in flux was not changed in culture-expanded WT,alpl+/-,and shALP-treated BMSCs when treated with 10 mmol·L-1EGTA(Fig.1b),suggesting that ALPL causes Ca2+elevation mainly due to Ca2+in flux with a limited contribution from intracellular Ca2+storage.Overexpression of ALPLinalpl+/-BMSCs rescued KCl-induced Ca2+in flux(Fig.1c).

The decrease in Ca2+currents inalpl+/-BMSCs could arise from the loss of channels at the membrane.The VGCCs comprise ten subsets:CaV1.1,CaV1.2,CaV1.3,CaV1.4(L-type),CaV2.1(P/Q-type),CaV2.2(N-type),CaV2.3(R-type),CaV3.1,CaV3.2,and CaV3.3(T-type),which are encoded by cacna1s,cacna1c,cacna1d,cacna1f,cacna1a,cacna1b,cacna1e,cacna1g,cacna1h,and cacna1i,respectively.20–21To identify which subunits of the VGCCs were regulated by ALPL,we measured the total protein expression of CaV1.1,CaV1.2,CaV1.3,CaV2.1,CaV2.2,CaV2.3,CaV3.1,CaV3.2,and CaV3.3,as CaV1.4 expression seems to be restricted to the retina.The results showed that the total protein expression of CaV1.2 and CaV1.3 was decreased signi ficantly inalpl+/-BMSCs compared with WT BMSCs(Fig.1d).Total protein expression of CaV1.1,CaV2.2,CaV2.3,and CaV3.3 was not changed(Figs.1d and S2e).However,total and membrane expression levels of CaV2.1,CaV3.1,and CaV3.2 were increased inalpl+/-BMSCs compared with WT BMSCs(Fig.S2e,f).The expression of CaV2.1,CaV3.1,and CaV3.2 in the cytoplasm was not changed signi ficantly inalpl+/-BMSCs compared with that of WT BMSCs(Fig.S2g).We used a plasma membrane protein extraction kit(Abcam,ab65400)to isolate plasma membrane protein,and then we measured the expression levels of membrane CaV1.1,CaV1.2,and CaV1.3.The results showed thatalpl+/-BMSCs expressed similar levels of CaV1.1 in the membrane and cytoplasm to what was observed in WT BMSCs(Fig.1e).Considering the decreased Ca2+in flux inalpl+/-BMSCs,we focused on CaV1.2 and CaV1.3.Membrane expression of calcium channels affects calcium in flux,and we compared the expression of CaV1.2 and CaV1.3 in the membrane and in the cytoplasm.The results showed that the expression levels of membrane,CaV1.2 and CaV1.3 were decreased inalpl+/-BMSCs,but the cytoplasmic levels did not change(Fig.1e).We also measured KCl-induced Ca2+in flux after knockdown of CaV1.2 or CaV1.3 in WT BMSCs.The results showed that knockdown of CaV1.2 or CaV1.3 reduced KCl-induced Ca2+in flux in WT BMSCs(Fig.S2h).Moreover,we labeled the surface molecules with biotin and used neutravidin ultralink resin beads to capture biotinylated surface proteins.Then,we used western blot analysis to show the expression levels of proteins captured by anti-CaV1.2 and CaV1.3 antibodies.The results showed that the amount of CaV1.2 or CaV1.3 on the cell surface was decreased inalpl+/-BMSCs compared with that of the WT BMSCs(Fig.1f).However,overexpression of ALPL increased the expression of CaV1.2 and CaV1.3 on the membrane,as assayed by western blot(Fig.1g).We also investigated the membrane localization of CaV1.2 and CaV1.3 in WTandalpl+/-BMSCs by confocal laser scanning microscopy.The results showed that CaV1.2(FITC-labeled)and CaV1.3(FITC-labeled)were localized to the membrane(as visualized by CellMask™Deep Red Plasma Membrane Stain)of WTBMSCs(Fig.1h,i).However,CaV1.2 and CaV1.3 were absent from the membrane ofalpl+/-BMSCs.CaV1.2 and CaV1.3 were localized to the cell membrane after overexpression of ALPL inalpl+/-BMSCs(Fig.1h,i).These results suggest that ALPLmodulates the expression of L-type Ca2+channels,especially CaV1.2 and CaV1.3.

ALPL-regulated MSCosteogenic/adipogenic lineage differentiation via the L-type Ca2+channel

We knocked down ALPL in BMSCs by siRNA treatment(Fig.S3a)and con firmed that ALPL de ficiency decreased the osteogenic differentiation and increased the adipogenic differentiation of BMSCs(Fig.S3b–e).To explore the function of long-lasting voltage-gated calcium channel(L-VGCC)in the osteogenic/adipogenic differentiation of BMSCs,we used L-type Ca2+channel blockers,diltiazem,or nifedipine,to treat WT BMSCs,and we explored their resulting osteogenic and adipogenic differentiation capacities(Fig.S3f–i).We found that both nifedipine and diltiazem inhibited the osteogenic differentiation ability of BMSCs,as evidenced by decreases in mineralized nodule formation and in expression of the osteogenic markers Bglap,Ibsp,RUNX2,and Sp7.In addition,nifedipine promoted the adipogenic differentiation of BMSCs,whereas diltiazem inhibited the adipogenic differentiation of BMSCs,asassessed by oil red Ostaining.The western blot assay data showed the same changes in the adipogenic regulators PPARγ2 and LPL under adipogenic culture conditions.To further address whether the defect in osteogenic/adipogenic lineage differentiation in ALPL-de ficient BMSCs was due to the abnormal membrane expression of VGCCs,especially CaV1.2 and CaV1.3,we overexpressed CaV1.2 and CaV1.3 inalpl+/-BMSCs(oeCaV1.2 or oeCaV1.3)(Fig.S3j).Western blot data showed that CaV1.2 and CaV1.3 were increased on the membrane ofalpl+/-BMSCs after CaV1.2 or CaV1.3 overexpression(oeCaV1.2 or oeCaV1.3)(Fig.S3k).KCl-induced Ca2+in flux was elevated after overexpression of CaV1.2 or CaV1.3 inalpl+/-BMSCs(Fig.2a).We also observed the membrane localization of CaV1.2 and CaV1.3 inalpl+/-BMSCs after overexpressing CaV1.2 or CaV1.3 by confocal laser scanning microscopy(Fig.2b,c).We found that overexpression of CaV1.2 or CaV1.3 inalpl+/-BMSCs(oeCaV1.2 or oeCaV1.3)rescued the decreased osteogenic differentiation of BMSCs,as evidenced by increases in mineralized nodule formation and in expression of the osteogenic markers RUNX2 and Sp7(Fig.2d,e).In contrast,overexpression of CaV1.2 or CaV1.3 (oeCaV1.2 or oeCaV1.3)decreased adipogenic differentiation of BMSCs,as assessed by oil red O staining,showing decreased numbers of adipocytes;further,western blots showed downregulation of the adipogenic regulators PPARγ2 and LPL under adipogenic culture conditions(Fig.2f,g).However,knockdown of CaV1.2 or CaV1.3(by treatment with siCaV1.2 or siCaV1.3,respectively)(Fig.S3l,m)in WT BMSCs caused decreased osteogenic and increased adipogenic differentiation(Fig.2h–k).These data indicate that ALPL regulates osteogenic and adipogenic lineage differentiation through CaV1.2-and CaV1.3-mediated calcium in flux.

ALPL de ficiency promoted the internalization of L-type Ca2+channels in BMSCs

To determine whether a lack of ALPL leads to channel internalization resulting in decreased membrane expression of L-type Ca2+channels in BMSCs,we disrupted endocytosis by expressing a dominant-negative mutant of dynamin 1(DN-Dyn1),which is a GTPase required for the formation of endocytic vesicles from the plasma membrane.22The expression of DN-Dyn1 inalpl+/-BMSCs prevented the loss of CaV1.2 and CaV1.3 on the cell surface(Fig.3a,b),providing evidence that a lack of ALPLcauses internalization of the channels.Western blot analysis showed that the expression levels of membrane CaV1.2 and CaV1.3 inalpl+/-BMSCs were increased after DN-Dyn1 transfection.However,the expression levels of cytoplasmic CaV1.2 and CaV1.3 inalpl+/-BMSCs were decreased after DN-Dyn1 transfection(Fig.3c).The expression of DN-Dyn1 also prevented the decrease in KClinduced Ca2+in flux inalpl+/-BMSCs(Fig.3e).

We next measured the time course of ALPL-dependent L-type Ca2+channel internalization.To study this process in live BMSCs,we used Dio to label the cell membrane(FITC-labeled)and constructed a plasmid to express CaV1.2(DsRed-Cav1.2)to use in the transfection of cells.We recorded colocalization regions as region of interest(ROI)to record the time-course change of intensity of red fluorescence,and we quanti fied the red florescence in each ROIover a time-course lapse at 300 s minus 0 s and 600 s minus 0 s to determine changes during the process.The DsRed-CaV1.2 signal inalpl+/-BMSCs declined signi ficantly after 10 min compared with that of the WT,DN-Dyn1-transfectedalpl+/-BMSCs,and ALPL-overexpressedalpl+/-BMSCs,re flecting the decreased membrane expression of the L-type Ca2+channel(Fig.3d,f and g).We also selected images at 0 s and 570 s to show the colocalization of DsRed-CaV1.2 with the cell membrane of BMSCs.Almost no region of colocalization was found inalpl+/-BMSCs(Fig.3h–k),which suggested that ALPL de ficiency promoted the internalization of L-type Ca2+channels.To determine whether the expression of DN-Dyn1 rescues differentiation in ALPL-de ficient BMSCs,we performed osteogenic and adipogenic induction after transfection.Expression of DN-Dyn1 increased osteogenic differentiation ofalpl+/-BMSCs,as evidenced by increased mineralized nodule formation and expression of the osteogenic markers RUNX2 and Sp7(Fig.S4a,b).In contrast,expression of DN-Dyn1 decreased adipogenic differentiation ofalpl+/-BMSCs,as assessed by oil red O staining,which showed decreased numbers of adipocytes,and western blotting,which showed downregulation of the adipogenic regulators PPARγ2 and LPLunder adipogenic culture conditions(Fig.S4c,d).

ALPLde ficiency promoted the internalization of L-type Ca2+channels via binding to α2δ subunits

Given that ALPL has been reported to hydrolyze inorganic pyrophosphate(PPi)and adenosine triphosphate(ATP),we compared the expression of CaV1.2 and CaV1.3 in BMSCs and BMSCs treated with PPi or ATP.However,the addition of exogenous PPi or ATPhardly changed the membrane expression of CaV1.2 and CaV1.3 in BMSCs(Fig.S5a).To further explore the molecular mechanism of ALPL-regulated internalization of CaV1.2 and CaV1.3,we measured the membrane localization of ALPLand calcium channels.We found that CaV1.2 and CaV1.3 overlapped with ALPL in BMSCs(Fig.4a,upper panel),suggesting the association of ALPL and L-type Ca2+channels.However,no membrane location of CaV1.2 and CaV1.3 was found inalpl+/-BMSCs(Fig.4a,lower panel).Several regions of ALPL and CaV1.2 and CaV1.3 colocalization were found in the cytoplasm ofalpl+/-BMSCs(Fig.4a,lower panel),indicating that ALPLmay bind L-type Ca2+channels in the cytoplasm.We also used immunoprecipitation to con firm the association of ALPL and the L-type Ca2+channel.Immunoprecipitation using a control antibody did not isolate either protein,but immunoprecipitation with anti-ALPL resulted in coimmunoprecipitation with CaV1.2 or CaV1.3(Fig.4b).In addition,we found that anti-CaV1.2 or anti-CaV1.3 immunoprecipitated ALPL(Fig.4c),suggesting that ALPL associates with CaV1.2 and CaV1.3 in BMSCs.

We next investigated which regions of CaV1.2 and CaV1.3 are important for ALPL-regulated internalization.The α2δ subunit has been reported to traf ficα1 subunits,which in fluences internalization of the channels.23–24Floxedalplmice withPrrx1::Cremice were crossed to generate early embryonic MSC-speci fic(Prrx1-alpl-/-)conditionalalplknockout mice(Fig.S5b,c).We isolated BMSCs from thePrrx1-alpl-/-mice(ALPL-/-)and controlalplf/flittermates(control).Alpl-/-BMSCs showed decreased expression of ALPL,and treatment with a lentivirus that overexpressed ALPL(Lenti-alp)elevated the membrane expression of ALPL(Fig.S5d).To explore whether ALPL interacted with α2δ to regulate the internalization of CaV1.2 and CaV1.3,we expressed ALPLwith α2δ or a mutantα2δ inalpl-/-BMSCs and examined the membrane expression of CaV1.2 and CaV1.3.alpl-/-BMSCs were isolated fromPrrx1-alpl-/-mice and showed no expression of ALPL,CaV1.2,or CaV1.3 at the membrane(Fig.4d).The membrane expression of CaV1.2 and CaV1.3 was increased,and ALPL was colocalized with CaV1.2 and CaV1.3 after transfection with ALPL and α2δ (Fig.4d).However,the membrane expression of CaV1.2 and CaV1.3 was not increased,and ALPL was not colocalized with CaV1.2 and CaV1.3 after transfection with ALPLand mutantα2δ (Fig.4d).Western blot analysis also con firmed that the membrane expression of CaV1.2 and CaV1.3 was increased after transfection with ALPL and α2δ(Fig.4e).However,no membrane expression of CaV1.2 and CaV1.3 was found inalpl-/-BMSCs andalpl-/-BMSCs transfected with ALPL and mutant α2δ (Fig.4e).Immunoprecipitation using a control antibody did not isolate either protein in WT oralpl-/-BMSCs,but immunoprecipitation with anti-α2δ inalplf/fBMSCs isolated ALPL(Fig.4f).To con firm that ALPL interacts with α2δ subunits and thus regulates the lineage differentiation of BMSCs,we transfectedalpl+/-BMSCs with α2δ or mutant α2δ and assessed their osteogenic or adipogenic induction.alpl+/-BMSCs transfected with mutant α2δ showed decreased osteogenic differentiation and increased adipogenic differentiation compared withalpl+/-BMSCs transfected with α2δ (Fig.S5e–h).

ALPLde ficiency caused aberrant lineage differentiation of BMSCs through the Wnt/β-catenin pathway

To examine how ALPL de ficiency-induced reduction of Ca2+in flux affects the osteogenic and adipogenic differentiation of BMSCs,we analyzed three Ca2+downstream pathways(PKC/Erk,PI3K/Akt/GSK3β,and CaMKII/calcineurine A),which are closely linked to Ca2+-associated regulation of osteogenic differentiation.We found that the expression level of p-Akt signi ficantly decreased along with the reduction of p-GSK3βinalpl+/-BMSCs and BMSCs transfected with shALP(Fig.5a).However,the PKC/Erk and CaMKII/calcineurine A pathways were not changed signi ficantly inalpl+/-BMSCs or in BMSCs transfected with shALP compared with that of WT BMSCs(Fig.S6a).Because the decrease in GSK3βphosphorylation inhibits the nuclear translocation ofβ-catenin,which regulates the osteogenic and adipogenic differentiation of BMSCs,we examined the expression levelsof totaland activeβ-catenin.We found that the expression of activeβ-catenin was decreased in bothalpl+/-BMSCs and BMSCs transfected with shALP(Fig.5a).Moreover,when we overexpressed ALPL inalpl+/-BMSCs,the expression of p-Akt,p-GSK3β,and active β-catenin was increased to levels similar to those of the WTBMSCs(Fig.5b).When we overexpressed CaV1.2 or CaV1.3 inalpl+/-BMSCs,the expression of p-Akt,p-GSK3β,and active β-catenin was increased(Fig.5c).In addition,the expression of DNDyn1 inalpl+/-BMSCs also increased the expression of p-Akt,p-GSK3β,and active β-catenin compared withalpl+/-BMSCs(Fig.5d).Taken together,these data indicate that ALPLregulates Ca2+in flux to affect p-Akt and p-GSK3βexpression and subsequently targets the Wnt/β-catenin pathway in BMSCs.

To further determine whether ALPL regulates osteogenic and adipogenic differentiation through the Akt/GSK3β/Wnt/β-catenin pathway,we used activators of Akt phosphorylation(sc79)and GSK3βphosphorylation(LiCl)(Fig.S6b)to treatalpl+/-BMSCs,and we found that sc79 and LiCl treatment increased osteogenic differentiation,as evidenced by increases in mineralized nodule formation and in expression of RUNX2 and Sp7(Fig.5e,f).In contrast,sc79 and LiCl treatment decreased adipogenic differentiation ofalpl+/-BMSCs,as assessed by oil red Ostaining,which showed a decreased number of adipocytes,and western blotting,which indicated a downregulation of PPARγ2 and LPL under adipogenic culture conditions(Fig.5g,h).Moreover,we also overexpressed β-catenin(oeβ-cat)inalpl+/-BMSCs(Fig.S6c)and observed a recovery of lineage differentiation inalpl+/-BMSCs,as evidenced by the increased osteogenic differentiation and decreased adipogenic differentiation(Fig.5i–l).

Raising the intracellular level of calcium by ionomycin rescued ALPLde ficiency-induced age-related osteoporosis

Ionomycin was reported to cause a robust increase in Ca2+in flux and an inhibition in calcium channel endocytosis.25Therefore,we treated 12-week-oldalpl+/-mice with ionomycin intraperitoneally at a dose of 1 mg·kg-1per day for 28 days.We con firmed that ionomycin treatment increased the calcium in flux and the membrane expression of CaV1.2 and CaV1.3 inalpl+/-BMSCs(Fig.S7a,b).MicroCTand histological analyses showed that bone mineral density(BMD),Bone volume relative to tissue volume(BV/TV),and distal femoral trabecular bone number(Tb.N)in 3-montholdalpl+/-mice were markedly decreased compared with that of the control WT littermates(Fig.6a,b).We treatedalpl+/-mice with ionomycin,which caused a robust rise in Ca2+in flux in cells.25MicroCT and histological analyses showed that BMD,BV/TV,and Tb.Nin 3-month-oldalpl+/-mice treated with ionomycin was markedly increased compared with that inalpl+/-mice(Fig.6a,b).To observe changes in osteogenic/adipogenic lineage differentiation in vivo,we examined the number of adipocytes in the bone marrow of WT,alpl+/-mice,andalpl+/-mice treated with ionomycin.Interestingly,oil red O staining showed that the number of adipocytes inalpl+/-mouse bone marrow was markedly increased compared with that of WT littermates(Fig.6c),indicating thatalplde ficiency increased adipogenic lineage differentiation.However,the number of adipocytes inalpl+/-mouse bone marrow after ionomycin treatment was markedly decreased compared with that ofalpl+/-mice(Fig.6c).To con firm thatalplde ficiency directly contributes to decreased osteogenesis,a calcein double labeling analysis was used to show a decreased bone formation rate inalpl+/-mice and an elevated bone formation rate inalpl+/-mice treated with ionomycin(Fig.6d).

Moreover,we found that the intracellular level of Ca2+inalpl+/-BMSCs was decreased compared with that of WT BMSCs,and ionomycin treatment elevated the intracellular level of Ca2+inalpl+/-BMSCs(Fig.6e).We observed impaired osteogenic differentiation and increased adipogenic differentiation inalpl+/-BMSCs,as evidenced by decreased mineralized nodule formation and an elevated numbers of adipocytes(Fig.6f,h).The decreased expression of the osteogenic markers RUNX2 and Sp7 and increased expression of the adipogenic regulators PPARγ2 and LPL were shown by western blotting(Fig.6g,i).Ionomycin treatment increased the osteogenic differentiation and decreased adipogenic differentiation ofalpl+/-BMSCs(Fig.6f–i).

Ionomycin treatment rescued osteoporosis in BMSC-speci fic conditionalalplknockout mice

To further determine whether ALPL de ficiency in BMSCs caused altered osteogenesis and adipogenesis in vivo,we assessed BV/TV and Tb.N in 3-month-oldPrrx1-alpl-/-mice,and we found that they were markedly decreased compared with that of their controlalplf/flittermates(Fig.7a,b).Floxedalpllittermates(alplf/f)were used as controls.MicroCT and histological analyses showed that,BMD,BV/TV,and Tb.N in 3-month-oldPrrx1-alpl-/-mice treated with ionomycin were markedly increased compared with what was observed in thePrrx1-alpl-/-mice(Fig.7a,b).To further detect changesin osteogenic/adipogenic lineage differentiation in BMSCs,we examined the number of adipocytes in the bone marrow ofalplf/f,Prrx1-alpl-/-mice,andPrrx1-alpl-/-mice treated with ionomycin.Oil red O staining showed that the number of adipocytes inPrrx1-alpl-/-bone marrow was markedly increased compared with that in the controlalplf/flittermates(Fig.7c).However,the number of adipocytes inPrrx1-alpl-/-bone marrow after ionomycin treatment was markedly decreased compared with that of thePrrx1-alpl-/-mice(Fig.7c).Calcein double labeling analysis showed a decreased bone formation rate inPrrx1-alpl-/-mice relative to that of controlalplf/fmice(Fig.7d).Ionomycin treatment reversed the impaired osteogenesis inPrrx1-alpl-/-mice.Moreover,the serum levels of RANKLand OPGwere not signi ficantly changed,as assessed by ELISA(Fig.S7c,d),suggesting that osteoclasts may not be altered inPrrx1-alpl-/-mice.The intracellular level of Ca2+inalpl-/-BMSCs was decreased compared with that in the control BMSCs,and ionomycin treatment elevated the intracellular level of Ca2+inalpl-/-BMSCs(Fig.7e).In addition,BMSCs fromPrrx1-alpl-/-mice showed decreased osteogenic differentiation and increased adipogenic differentiation compared with BMSCs fromalplf/fmice(Fig.7f–i).BMSCs fromPrrx1-alpl-/-mice treated with ionomycin showed increased osteogenic and decreased adipogenic differentiation(Fig.7f–i).These results indicate that ALPL de ficiency in BMSCs induces an age-related osteoporosis phenotype and that ionomycin treatment reversed this phenotype.

ALPL de ficiency promoted the internalization of L-type Ca2+channels in HPPpatient-derived BMSCs

We also collected bone marrow BMSCs from two HPP patients with mutations in the ALPL gene(A1 and A2,Table S1).The expression of ALPL on the membrane and cytoplasm was decreased in BMSCs from the two HPP patients compared with normal human bone marrow BMSCs(control)(Fig.8a).We further determined whether the lack of ALPL resulted in decreased KClinduced Ca2+in flux in A1 and A2 BMSCs.KCl-induced Ca2+in flux was signi ficantly decreased in culture-expanded A1 and A2 BMSCs compared with that of control BMSCs(Fig.8b),and overexpression of ALPLelevated KCl-induced Ca2+in flux(Fig.8c,d)in A1 and A2 BMSCs.Moreover,we also found that the expression of DN-Dyn1 prevented the decrease in KCl-induced Ca2+in flux in A1 and A2 BMSCs(Fig.8c,d).The overexpression of ALPL or expression of DN-Dyn1 in A1 and A2 BMSCs increased the membrane expression of CaV1.2 and CaV1.3,as shown by confocal images(Fig.8e),suggesting that ALPL de ficiency causes channel internalization of CaV1.2 and CaV1.3 in a human model.To con firm that ALPL regulates the lineage differentiation of BMSCs,we overexpressed ALPL in A1 and A2 BMSCs and assessed their osteogenic or adipogenic ability after induction.A1 and A2 BMSCs transfected with the ALPL vector showed increased osteogenic differentiation and decreased adipogenic differentiation (Fig.S8a–d).All of the above data show that ALPL regulates lineage differentiation of MSCs through association with the α2δ subunit of L-type Ca2+channels and through inhibiting the internalization of L-type Ca2+channels,thus increasing Ca2+in flux(Fig.S9).

DISCUSSION

The de ficiencies caused HPP are currently treated by bone anabolic and/or enzyme replacement strategies.Bone anabolic treatment,such as treatment with recombinant human parathyroid hormone analogs yielded debatable ef ficacy.26Asfotase alfa(Strensiq,Alexion),a bone-targeted enzyme replacement therapy,was approved for the long-term treatment of pediatric-onset HPP in the United States,Europe,Canada,and Japan.However,there are no guidelines for selecting adult patients for treatment,evaluating the results of treatment,or determining the optimal duration of treatment at this time.Patients with HPP can also develop secondary osteoporosis,bone marrow edema,and delayed fracture healing or dif ficulties with implant failure.26Thus,there is an urgent need to identify further bone-targeted treatment options for adult HPPpatients.

Our previous study showed that the Alpl de ficiency results in premature bone aging characterized by bone mass loss and simultaneous marrow fat gain.Although a pivotal role for ALPLin skeletal matrix mineralization has been established,the mechanism of ALPL regulating BMSC differentiation remains uncertain.Hypercalcemia was found in severely affected infants with HPP,which suggests that ALPL may modulate calcium homeostasis.In this study,we found that raising the intracellular level of calcium in BMSCs by ionomycin rescued ALPLde ficiencyinduced age-related osteoporosis,which suggests that targeting calcium channels is a new approach for adult HPP treatment.Moreover,our study showed a new function for ALPL in controlling Ca2+in flux by regulating the internalization of calcium channels,which balanced the osteogenic and adipogenic differentiation of BMSCs.

Voltage-dependent calcium channels are an important route by which Ca2+enters cells upon membrane depolarization to regulate calcium homeostasis.A previous study showed that VGCCs in BMSCs and osteoblasts regulate bone formation and that manipulating VGCCs promotes bone repair.27–28Of note,the L-VGCC,a major channel of calcium in flux,is a part of the highvoltage activated family of VGCCs.L-type calcium channels are considered to play an important role in regulating BMSC function.15–16L-VGCCs,which consist of four subunits(CaV1.1,CaV1.2,CaV1.3,and CaV1.4),are expressed in a tissue-speci fic fashion.29CaV1.2 and CaV1.3 constitute the major fraction of L-type calcium channelsin mammals.30–32However,how CaV1.2 and CaV1.3 are regulated in BMSCs is still unknown.Here,we found that a lack of ALPL caused a decreased number of CaV1.2 and CaV1.3 cells in the membrane and a decrease in Ca2+in flux in BMSCs,which led to the aberrant lineage differentiation of BMSCs.

The involvement of ALPL in channel internalization leads to a change in the CaV1.2 and CaV1.3 number at the surface of cells.Several other proteins have been found to regulate the membrane expression of VGCCs,including calmodulin,Akap15,Akap9,and eIF3e,and these associations play an important role in connecting VGCCs and intracellular signaling pathways.25Of these proteins,ALPL is unusual because it is an ectoenzyme that hydrolyzes several substrates.Our study showed a new function for ALPLin in BMSCs;it controls Ca2+in flux by regulating the internalization of CaV1.2 and CaV1.3.The results suggest that ectoenzymes on the cell membrane may bind channels in the cell and regulate their traf ficking.Precisely how ALPL regulates L-type Ca2+channel traf ficking is unclear.Our colocalization data indicate that there is direct contact between ALPL and L-type Ca2+channels.The α2δ subunit of the L-type Ca2+channel is responsible for regulating the traf ficking of channels.23–24Our colocalization data indicate that ALPL may bind to the α2δ subunit to regulate L-type Ca2+channel traf ficking.A mutation in the α2δ subunit reduced the expression of CaV1.2 and CaV1.3 at the membrane of cells.However,further studies are required to explore the detailed mechanism of L-type Ca2+channel traf ficking.Conditional binding of ALPL to CaV1.2 and CaV1.3 suggests that the composition of the CaV1.2 and CaV1.3 protein complex with ALPL may play an important role in regulating channel traf ficking.On the other hand,our previousstudy showed that ALPLde ficiency in BMSCs enhanced ATP release and reduced ATP hydrolysis.3ATP,as the energy source used in channel traf ficking,may also play a critical role in L-type Ca2+channel internalization in ALPL de ficiency conditions.

Skeletal defects in HPP,include rickets,osteomalacia,fractures,bone pain,and various dental defects.33–34To understand the physiological role of ALPLand evaluate the potential treatments,several lines of ALPL knockout mice were generated.35–36Homozygous mice show severe bone disease,but they often die before puberty.37However,here,we found that ALPLde ficiency in BMSCs caused decreased osteogenic differentiation and increased adipogenic differentiation.Thealpl+/-mouse model phenocopies adult patients with HPP,and these mice showed inhibited bone formation but increased adipose tissue in the bone matrix.Moreover,bone formation was inhibited when we generatedalplconditional knockout mice of BMSCs,which was consistent with recent reports.37Further,other recent data have shown that increased marrow adipose tissue is correlated with dysfunction of bone and hematopoietic regeneration.38We also found that bone formation was inhibited but adipose tissue was increased in the bone matrix ofalplconditional knockout mice,which suggests that ALPL regulates the osteogenic/adipogenic differentiation of BMSCs and causes osteoporosis in patients with HPP.

Our findings regarding the involvement of ALPL in calcium homeostasis revealed a molecular mechanism underlying the BMSC balance between osteogenic and adipogenic differentiation.The change in Ca2+in flux in BMSCs following H2Sexposure regulates osteogenic differentiation through the PCK/Erk/Wnt pathway.39Here,we demonstrated that the Akt/GSK3β/Wnt/β-catenin pathway was downstream of ALPL-mediated regulation of Ca2+in flux.The Akt/GSK3β/Wnt/β-catenin pathway further balanced the osteogenic and adipogenic differentiation of BMSCs and bone formation.In our study,we found that ALPL was required to maintain intracellular Ca2+in flux by regulating internalization of the L-type Ca2+channel via binding to the α2δ subunits in BMSCs.Altered intracellular Ca2+in flux caused by the ALPLde ficiency resulted in an osteoporotic phenotype due to downregulated osteogenic differentiation and upregulated adipogenic differentiation in both human and mouse BMSCs.Inhibition of calcium channel internalization by ionomycin increased calcium in flux and enhanced bone formation inalpl+/-mice andPrrx1-alpl-/-mice,suggesting that targeting calcium channel internalization is a potential treatment strategy for adult patients with HPP.

MATERIALSAND METHODS

Mice

C57BL/6J and B6.129S7-Alpltm1Sor/J mice were purchased from Jackson Laboratory(Bar Harbor,ME,USA).We produced mice that were homozygous for ALPLfloxusing the CRISPR/Cas9 system;an ALPL allele was generated in which the DNA segment includes exons 3 and 4 was flanked byloxPsites.By coinjection of Cas9/sgRNAs and the ALPLtargeting vector into zygotes,we generated ALPL-fl oxed heterozygous mice.To generate a tissue-speci fic Cremediated ALPL knockout model,Prrx1-Cre(C57BL/6-Prrx1tm1(iCre)/Bcgen)(Beijing Biocytogen Co.,Ltd Beijing,China)mice were mated with mice heterozygous for the ALPL-fl oxed allele.The offspring inherited Prrx1-Cre and two ALPL-fl oxed alleles.Routine mouse genotyping was performed by PCR.The following primer pairs were used for Cre and floxed alleles:Prrx1iCreprimer 1:AGCGTTTGGTGTTGATTCGAGC;Prrx1iCreprimer 2:AGTCCCGGTG ACTCCAGCAG;Prrx1iCreprimer 3:TGGTGCACAGTCAGCAGGTTG;ALPL-3′loxP-F:CCTGCTACCTGCTTGCTGGCAATGG;ALPL-3′loxP-R:AGGACACCAAAGACCAGGGACACTA.All animal experiments were performed in accordance with institutionally approved protocols for the use of animal research(University of Fourth Military Medical University protocol number k9-024).

Isolation of mouse bone marrow mesenchymal stem cells

Bone marrow cells were flushed from the bone cavities of mouse femurs and tibias with 2%heat-inactivated fetal bovine serum(FBS;Hangzhou Sijiqing Biological Engineering Materials Co.,Ltd Zhejiang,China)in PBS.A single-cell suspension of all nucleated cells was obtained by passing all bone marrow cells through a 70μm cell strainer(BD Bioscience,NJ,USA).Single cells(1×106)were seeded in 100 mm culture dishes(Corning,NY,USA)and initially incubated for 48 h at 37°Cand 5%CO2.To eliminate the nonadherent cells,the cultures were washed with PBStwice on the second day.The attached cells were cultured for 16 days in alpha minimum essential medium (α-MEM,Gibco BRL,Gaithersburg,MD,USA)supplemented with 20%FBS,2 mmol·L-1l-glutamine(Invitrogen Life Technology,Carlsbad,CA,USA),55 μmol·L-12-mercaptoethanol(Invitrogen),100 U·mL-1penicillin,and 100 μg·mL-1streptomycin(Invitrogen).To con firm that the cells had mesenchymal stem cell characteristics,we used flow cytometric analysis to show that these BMSCs were positive for Sca-1,CD44,and CD73 and were negative for CD34 and CD45(BD Biosciences,San Diego,CA,USA).

Isolation of human bone marrow mesenchymal stem cells

Two HPP patients aged 10(male)and 2.5(female)years were treated by the Af filiated Hospital of Fourth Military Medical University for osteodynia and missing teeth.Healthy human BM samples were collected from five teenagers aged 10–13 years(male)who underwent alveolar bone cleft repair by autoilium transplantation.The cells were puri fied from the BM using a Percoll density gradient centrifugation method,and then they were cultured inα-MEM supplemented with 10%FBS(Gibco BRL),2 mmol·L-1L-glutamine(Invitrogen),100 U·mL-1penicillin,and 100 mg·mL-1streptomycin(Invitrogen)at 37 °C in 5%CO2.3BMSCs in their third passage were used in experiments.

Calcium imaging

Calcium imaging was performed using confocal laser microscopy(Zeiss,Oberkochen FV1000,Germany).The intracellular Ca2+level([Ca2+]i)was determined by Fluo-3 fluorescence intensity,as described previously.40Brie fly,BMSCs were cultured in 12-well plates and were incubated with 5 μmol·L-1Fluo-3/AM dye(Invitrogen,Life Technology,Carlsbad,CA,USA)for 30 min inα-MEM at 37°C.BMSCs were again washed three times with calibrated EGTA/Ca2+solutions.KCl(30 mmol·L-1)or TG(20 μmol·L-1,Sigma-Aldrich,St.Louis,MO,USA)was added to test which type of calcium channel was affected.Images were collected every 4 s at 2 Hz with excitation at 488 nm and emission at 530nm.Data are presented asthe Fluo-3 fluorescence intensity increase ratio:R=ΔF/F0,whereΔF=F–F0.Fis the fluorescence value detected,andF0is the minimum fluorescence value.

Confocal microscopy

Confocal images were acquired with a Zeiss Oberkochen FV1000 confocal laser scanning microscope using a×60 oil immersion objective.BMSCs were fixed with 3.7%paraformaldehyde in distilled water at 4°C for 10 min and then were incubated overnight with primary antibodies,which were followed by incubation with secondary antibodies for 1h.The nuclei were stained with 1 μg·mL-1Hoechst 33342.The plasma membrane was stained with 5 μg·mL-1of the membrane marker CellMask™Deep Red Plasma Membrane Stain(Thermo Fisher Scienti fic,MA,USA).Images were acquired using an argon laser(excitation,488 nm;emission,BP505-530 nm emission filter)for FITC-labeled CaV1.2 or CaV1.3,a UV laser for excitation and a BP385-470 nm emission filter for Hoechst 33342,and a He–Ne laser(excitation,543nm;emission filter,LP650 nm)for Cy3-labeled ALPL.BMSCs(1×105)were plated onto coverslips,and the next day cells were treated with 10 μmol·L-1ATP,10 μmol·L-1ppi,or 1 μg·mL-1ionomycin for 1 h before immuno fluorescence staining for CaV1.2 or CaV1.3.Plasma membrane localization of CaV1.2 or CaV1.3 in BMSCs,as visualized by staining with anti-CaV1.2 or anti-CaV1.3 antibodies,was recorded for more than ten cells.Colocalization of the L-type Ca2+channel(CaV1.2 or CaV1.3)and ALPL was also observed using a laser scanning confocal microscope,and images were obtained using FV10-ASW Viewer 4.2(Zeiss,Oberkochen FV1000,Germany).

To record the time-course change of internalization of CaV1.2,a plasmid encoding DsRed-Cav1.2 was generated and transfected into the BMSCs.The plasmid was constructed by introducing a DsRed segment into the CaV1.2 plasmid(Addgene plasmid#26572)according to the instructions of a ClonExpress®II One Step Cloning kit(Vazyme,Nanjing,China).Dio(Thermo Fisher Scienti fic,MA,USA)was used to label the cell membrane,and DAPI(Thermo Fisher Scienti fic)was used to label the nucleus.The average colocalization intensity was determined by selecting an ROI corresponding to the cell’s footprint in the first image and measuring the average intensity in that region over the entire time course.The ROIwas visually selected in a region of the Diolabeled plasma membrane.Cells that were outside of this ROI were excluded from analysis.The amount of time channels spent at the membrane was measured for more than 15 ROIs for at least five cells per condition.We recorded the time-dependent red fluorescence intensity of these regions.Quantitative data are presented as the fluorescence intensity increase ratio:R=F/F0.Fis the fluorescence value detected,andF0is the first detected fluorescence value.Quanti fication of the fluorescence density of ROIs at 0 s,300 s,and 600 s was analyzed by NIHImageJsoftware.

Cell-surface protein isolation

The expression level of Ca2+channels in the surface membrane was determined by isolating cell-surface proteins using a plasma membrane protein extraction kit(Abcam,Cambridge,UK).In brief,the cells were lysed using homogenization buffer containing protease inhibitor cocktail.The homogenate was centrifuged for 10 min at 700g,and the pellet was discarded.The supernatant was then centrifuged for 30 min at 10 000gand 4°Cto obtain the total cellular membrane protein.Then,puri fication of the plasma membrane proteins was carried out according to the manufacturer’s protocol.The protein concentrations were measured with a Bradford protein assay kit(Beyotime,Shanghai,China).Then,equal amounts of the cytoplasmic and membrane proteins were saved as direct input for immunoblot experiments.

Osteogenic differentiation

BMSCs were cultured under osteogenic culture conditions in growth medium containing 2mmol·L-1β-glycerophosphate(Sigma-Aldrich,St.Louis,MO,USA),100 μmol·L-1L-ascorbic acid 2-phosphate(MP Biomedicals,Irvine,CA,USA),and 10nmol·L-1dexamethasone(Sigma-Aldrich,St.Louis,MO,USA).Two weeks after induction,staining was performed with 1%alizarin red S(Sigma-Aldrich)for 3 min at room temperature to detect matrix mineralization.Then,10 μmol·L-1SC79 or 10 mmol·L-1LicL was added to the osteogenic culture medium for induction.The stained areas were quanti fied using NIHImageJsoftware and are shown as a percentage of the total area.

Adipogenic differentiation

For adipogenic induction,500 nmol·L-1isobutylmethylxanthine(MP Biomedicals,Irvine,CA,USA),60 μmol·L-1indomethacin(Sigma-Aldrich),500 nmol·L-1hydrocortisone(MP Biomedicals,Irvine,CA,USA),10 μg·mL-1insulin (Sigma-Aldrich),and 100 nmol·L-1L-ascorbic acid phosphate were added into the growth medium.Then,10 μmol·L-1SC79 or 10 mmol·L-1LicLwas added to the adipogenic culture medium for induction.After 7 days,the cultured cells were stained with oil red O(Sigma-Aldrich),and positive cells were quanti fied under microscopy and are shown as a percentage of the total cells.

Western blotting

Cells were lysed using M-PER mammalian protein extraction reagent(Thermo,MA,USA)with protease and phosphatase inhibitors(Roche,Basel,Switzerland),and proteinswere quanti fied using protein assays(Bio-Rad Laboratories,Shanghai,China).Twenty micrograms of protein was separated by SDS-PAGEand then were transferred to nitrocellulose membranes(Millipore,Billerica,MA,USA).Membranes were blocked with 0.1%Tween-20 and 5%BSA for 1 h before overnight incubation with a primary antibody diluted in blocking solution.Antibodies against mouse ALP were purchased from R&D Systems,and antibodies against CaV1.1,CaV1.2,CaV1.3,CaV2.1,CaV2.2,CaV3.1,CaV3.2,CaV3.3,and CaVα2δ1 were purchased from Alomone Labs(Alomone,Jerusalem,Israel).Antibodies against mouse phospho-Erk1/2(Thr202/Tyr204),Erk1/2,GSK3β,phospho-GSK3β,phospho-AKT,β-catenin,RUNX2,SP7,Bglap,PPARγ2,LPL,phospho-PKC,PKC,phospho-CamkII,and AKT were purchased from Abcam(Cambridge,UK).Antibodies against mouse Ibsp were purchased from Absin(Shanghai,China).Antibodies against mouse CamkII and active β-catenin were obtained from Millipore(Billerica,MA,USA).Antibodies against mouseβ-actin were purchased from Boster(Wuhan,China).The membranes were incubated for 1 h in HRP-conjugated secondary antibody diluted at 1:40 000 in blocking solution.Immunoreactive proteins were detected using an enhanced chemiluminescence kit(Amersham Biosciences,Piscataway,NJ,USA).The intensity of bands was measured using NIH ImageJsoftware,and data were normalized toβ-actin.

Coimmunoprecipitation

To test whether ALPL and L-VGCC(CaV1.2 or CaV1.3)interact in cells,coimmunoprecipitation was performed as previously described.41The cells were completely lysed in cell lysis buffer for western blotting and IP(Beyotime,Shanghai,China).The lysates were incubated with primary antibodies overnight at 4°C,and then protein A/Gmagnetic beads(Millipore,USA)were added for 2 h at 4°C.Immunocomplexes were washed three times with PBScontaining 0.1%Tween-20 and were subsequently subjected to western blot analysis.

Biotinylation assays

A surface biotinylation assay was performed following the manufacturers’protocols for EZ-link Sulfo-NHS-LC-LC-biotin and Immobilized/NeutrAvidin Ultralink Resin(Thermo Fisher Scienti fic,MA,USA).For the surface biotinylation assay,the cells were incubated with 1 mg·mL-1EZ-linked Sulfo-NHS-LC-LC-biotin in DPBSfor 30min at room temperature,and unreacted biotin was quenched with cold 100 mmol·L-1glycine in DPBS.Then,we used neutravidin ultralink resin beads to capture biotinylated surface proteins.The beads were washed three times with lysis buffer(50mmol·L-1Tris/HCl[p H 7.4],1 mmol·L-1EDTA,150mmol·L-1NaCl,and protease inhibitors),and then elution was performed with loading buffer.After SDS-PAGE,western blot analysis of the captured proteins was performed with anti-CaV1.2 and anti-CaV1.3 antibodies(Alomone,Jerusalem,Israel).

Plasmid construction

For shRNA knockdown experiments,we constructed an shALPL lentiviral vector according to the protocol of the p LKO.1-TRC cloning vector.42In brief,to generate oligos for cloning into p LKO.1,we synthesized the following oligonucleotides:forward oligo:CCGGGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAAT TCATACTGCTTTTTG,reverse oligo:AATTCAAAAAGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGC.

Then,the forward and reverse oligoswere annealed and ligated into the p LKO.1 vector,producing a final plasmid that expressed an shRNA targeting ALPL.To overexpress ALPL in BMSCs,we constructed a lentiviral vector with ALPL cDNA.The ALPL(GenBank Accession No.NM_000478.5)cDNA was ampli fied by PCR using the primer pairs:forward:5′-ACTGGATCCTCCAGGGATAAAGCAGGTCT-3′;reverse:5′-TATCTCGAGTGGGAAGTTGGCATCTGTC-3′.Then,the ALPL gene was inserted into the vector p ENTRTM2B(Invitrogen Life Technology,Carlsbad,CA,USA),and a Gateway LR recombination reaction between the ALPL clone vector and p Lenti6.3/V5-DEST was performed to generate the expression clone Lenti-ALPL.The cDNA encoding β-catenin(GenBank Accession No.NM_007614.3)was ampli fied by TaKaRa LA Taq polymerase with GCBuffer(TaKaRa,Japan).Primers were used as follows:forward:5′-CGGGGAGGCGGAGACGGAGCAC-3′,reverse: 5′-CCAGCCCACCCCTCGAGCCCTCTC-3′. Then, the restriction enzymes SalI and BamHI were used to introduce the above fragment into the backbone vector p IRES2-EGFP(Clonetech,USA).

p DsRed-Cav1.2 was constructed using a ClonExpress Ultra One Step Cloning kit according to the manufacturer’s protocol(Vazyme,Nanjing,China).In brief,Cav1.2 was ampli fied by primers:forward:5′-GGGGTACCATGGTCAATGAAAACACGAGG-3′,reverse:5′-ATAAGAATGCGGCCGCCTACAGGTTGCTGACGTAGGAC-3′from p CaV1.2(Addgene,Plasmid#26572).Then,the fragment was introduced into the vector p CaV1.2 by restriction enzymes KpnIand NotIto construct the recombinant plasmid p CaV1.2-KN.DsRed was ampli fied from p LVX-EF1α-DsRed-monomer-N1(Biovector NTCC Inc.,Beijing,China)with the following primers:forward 5′-GGGAGACCCAAGCTGGCTAGC ATGGACAACACCGAGGACGTCAT-3′, and reverse: 5′-GTTTTCATTGACCATGGTACC CTGGGAGCCGGAGTGGCG-3′.Finally,the DsRed fragment was ligated with linearized p CaV1.2-KN by ExnaseII to construct p DsRed-Cav1.2.

Transfection

For transfecting experiments,BMSCs(0.5×106)were seeded on a six-well culture plate and then were transfected with CaV1.2 siRNA or CaV1.3 siRNA(Santa Cruz,Dallas,TX,USA)using X-tremeGENE siRNA Transfection Reagent(Roche,Basel,Switzerland)according to the manufacturer’s instructions.

To downregulate or overexpress ALPL in BMSCs,we first produced lentivirusescarrying shALPLor ALPLcDNA.The lentiviral vector and the ViraPower Packaging Mix were cotransfected into 293Tcells to produce a lentiviral stock according to the protocol provided by the manufacturer.Virus-containing supernatants were harvested 48 h after transfection,and then they were pooled and filtered through 0.45-μm filters.Cells were treated with a lentivirus at a multiplicity of infection of 100 at 37°Cand 5%CO2.The plates were swirled every 15 min,and fresh medium was added after 1 h of incubation.The cells were exposed to lentivirus for 48 h,which was followed by protein extraction for western immunoblotting or differentiation induction.

The following plasmids were used in transfection experiments:p Catenin-EGFP,p CaV1.2(Addgene,Plasmid#26572),p CaV1.3(Addgene,Plasmid #49332),DN-Dyn1 (Addgene,Plasmid#55795),p CaVα2δ1(Addgene,Plasmid#26575),and p CaVα2δ1mut(Addgene,Plasmid#58730).Transfections were performed according to the protocol of X-tremeGENEHPDNATransfection Reagent(Roche,Basel,Switzerland).After transfection,protein was extracted from cells for western immunoblotting,differentiation induction,and confocal imaging.

MicroCTanalysis

Femurs were harvested and analyzed using a desktop microCT system(eXplore Locus SP,GEHealthcare,USA).The scanner was set at a voltage of 80 kVp,a current of 80μA and a resolution of 8μm per pixel.Cross-sectional images of middiaphysis femurs were used to perform three-dimensional histomorphometric analysis of trabecular bone.Cross-sectional volumetric BMD was measured for the right femur middiaphysis with a density phantom.Using three-dimensional images,an ROI in the secondary spongiosa was manually drawn near the endocortical surface.Bone volume relative to tissue volume(BV/TV)and Tb.N were assessed as cancellous bone morphometric parameters.

Histology

To assess the areas of trabecular bone and bone marrow,femurs and tibias were fixed in 4%paraformaldehyde(Sigma-Aldrich,St.Louis,MO,USA)and then were decalci fied with 5%EDTA(p H 7.4),which was followed by paraf fin embedding.The 6μm paraf fin sections were stained with hematoxylin and eosin(H&E)and were analyzed using NIH ImageJ software.To label the matrix mineralization,the mice were given intraperitoneal injections of calcein(Sigma-Aldrich,USA,20 mg·kg-1body weight)at day 10 and day 3 before sacri fice.Bone dynamic histomorphometric analyses for MARwere performed according to the standardized nomenclature for bone histomorphometry using fluorescence microscopy(Leica DM 6000B,German).

In vivo oil red O staining

To assess adipose tissue in trabecular areas,femurs were fixed in 4%paraformaldehyde and were decalci fied with 5%EDTA(p H 7.4),which was followed by cryosectioning.Sections were stained with oil red O,and positive areas were quanti fied under microscopy and are shown as a percentage of the total area.Brie fly,sections were washed with 60%isopropanol and then were incubated in fresh oil red O staining solution for 15 min at room temperature before being counterstained with hematoxylin.All reagents for oil red O staining were purchased from Sigma-Aldrich.

Ionomycin treatment

Ionomycin(Alomone,Jerusalem,Israel)was dissolved in DMSO.For in vivo treatment,ionomycin was intraperitoneally administered to 12-week-oldalpl+/-mice andalpl-/-CKOmice at a dose of 1 mg·kg-1per day for 28 days.The control mice were treated with only the vehicle.After ionomycin treatment,all groups of mice were healthy.

Statistics

All experimental group sizes were chosen to ensure adequate statistical power despite the highly variable nature of the studies performed.No animals were excluded,and animals were randomly assigned groups for the studies.Experiments were not performed in a blinded fashion.Data were assessed for normal distribution and similar variance between groups.Comparisons between two groups were performed using independent unpaired two-tailed Student’sttests,and comparisons between more than two groups were analyzed using one-way ANOVAwith the Bonferroni adjustment.Pvalues of less than 0.05 were considered statistically signi ficant.

ACKNOWLEDGEMENTS

This study was funded by grants from the National Natural Science Foundation of China(Nos.81620108007 and 81870768),the National Key Research and Development Program of China(Nos.2016YFC1101400 and 2017YFA0104800),the Scienti fic Young Alma of Shaanxiprovince(2018KJXX-015)and a Schoenleber pilot grant from the University of Pennsylvania School of Dental Medicine.

AUTHORCONTRIBUTIONS

B.L.,X.H.,and Z.D.performed the animal experiments,immuno fluorescence staining and immunoblotting,cultured cells,collected data,analyzed the data,and produced all figures and tables.K.X.collected the cells from patients,and W.S.and L.G.helped with the immuno fluorescence staining and participated in the animal surgery.S.L.,W.L.,C.H.,and Y.Z.helped with data analysis.S.S.and Y.J.designed the experiments,oversaw the collection of the results and data interpretation and drafted the reports.All authors have seen and approved the final version of this paper.

ADDITIONAL INFORMATION

The online version of this article (https://doi.org/10.1038/s41413-020-0090-7)contains supplementary material,which is available to authorized users.

Competing interests:The authors declare no competing interests.

免责声明

我们致力于保护作者版权,注重分享,被刊用文章因无法核实真实出处,未能及时与作者取得联系,或有版权异议的,请联系管理员,我们会立即处理! 部分文章是来自各大过期杂志,内容仅供学习参考,不准确地方联系删除处理!