Enhancing gene editing efficiency for cells by CRISPR/Cas9 systemloaded multilay

Xuanyu Li,Qiang Feng,Ziwei Han,Xingyu Jiang

Shenzhen Bay Laboratory,Department of Biomedical Engineering,Southern University of Science and Technology,Shenzhen 518055,China

Keywords:Nanotechnology Biomedical engineering Microfluidics CRISPR/Cas9 system Poly(lactic-co-glycolic acid)

ABSTRACT Most non-viral carriers for in vitro delivery of nucleic acids suffer from low efficiency of introducing mRNA and other nucleic acids,especially large mRNA.Cas9 protein is the nuclease part of the powerful gene-editing tool,CRISPR/Cas9 system,Cas9 mRNA is particularly large,thus presents a big challenge for delivery.We assembled a multilayered biodegradable nanocarrier to load Cas9 mRNA inside to protect Cas9 mRNA from degradation.We used a microfluidic chip to synthesize a small,positively charged,and degradable core to attract negatively charged Cas9 mRNA.The microfluidic assembly allows the core to be small enough to incorporate into a cationic liposome.The multilayered nanocarriers elevated the delivery efficiency of Cas9 mRNA by over 2 folds and increased the expression by over 5 folds compared to commercially used non-viral carriers.In addition,the multilayered nanocarriers do not require reduced serum medium for transfection.When using the standard complete medium for transfection,the multilayered nanocarriers could increase the expression of Cas9 mRNA by over 15 folds compared to commercially used non-viral carriers.The co-delivery of Cas9 mRNA and sgRNA via LRC elevated the gene-editing efficiency by 3 folds compared to that via commercially used non-viral carriers.Based on the higher transfection efficiency of Cas9 mRNA/sgRNA than commercially used non-viral carriers,these multilayered nanocarriers may have a good prospect as efficient commercial delivery carriers for Cas9 mRNA/sgRNA and other nucleic acids.

1.Introduction

We devised a microfluidic approach to assemble multilayered nanocarriers for delivering Cas9 mRNA and CRISPR guide RNA(sgRNA).CRISPR/Cas9 system is an efficient gene-editing tool discovered from bacteria and adapted to gene editing for mammals[1–3].CRISPR/Cas9 system is composed of a sgRNA for targeting a DNA sequence and a Cas9 endonuclease to induce an indel mutation at the target DNA site [4,5].Researchers deliver DNA or RNA version of sgRNA,and DNA,RNA or protein version of Cas9 into cells to edit the target genes.DNA versions of sgRNA and Cas9 are the slowest combination to function as a gene-editing tool inside the cells and may integrate into the genome of the host cells.So a good strategy is to deliver RNA versions of sgRNA and Cas9,or the protein version of Cas9 into the host cells.

Researchers deliver the CRISPR/Cas9 system,mainly in three ways:viral carriers[6,7],non-viral carriers[8–10]and electroporation [11,12].Viral carriers have high in vitro and in vivo delivery efficiency.Still,the design of viral carriers is complicated and time-consuming and viral carriers may cause some problems to biosafety.The assembly of non-viral carriers is fast but suffers from low delivery efficiency.Electroporation has the highest transfection efficiency,but it requires complicated equipment.Commercially used lipofectamine 3000 is widely used for delivering nucleic acids,but it suffers from low delivery efficiency for Cas9 mRNA/sgRNA.Because lipofectamine 3000 loads nucleic acids on the surface,Cas9 mRNA/sgRNA could be degraded by RNase before entering the cells.We developed Au-based non-viral nanocarriers to incorporate CRISPR/system inside,protecting the CRISPR/Cas9 system before entering the cells [8].The Au-based nanocarriers have a positively charged gold core to attract the negatively charged Cas9 protein and sgRNA on the surface and incorporate into a cationic liposome as a whole.

In this work,we developed a microfluidic method to assemble the non-viral multilayered nanocarriers to incorporate Cas9 mRNA/sgRNA inside.The nanocarriers were made of biodegradable materials.We replaced the gold core with biodegradable and positively charged core to attract the negatively charged Cas9 mRNA and incorporated the whole assembly into a cationic liposome.The biodegradable and positively charged core should be small enough to incorporate into the cationic liposome.Poly (lactic-coglycolic acid) (PLGA) and many lipids are Food and Drug Administration (FDA)-approved materials for clinical applications.They have good biocompatibility and biodegradability [13].We used to synthesize 40–70 nm PLGA/lipid hybrid nanoparticles in a microfluidic chip [14–17].The microfluidic chip has a good reproducibility for assembling the small PLGA/lipid nanoparticles.Thus in this work,we used the same microfluidic chip to coat cationic lipid onto the PLGA core to construct a small,biodegradable and positively charged core to attract the negatively charged Cas9 mRNA/sgRNA.This core is small enough to incorporate into the cationic liposome with Cas9 mRNA/sgRNA.This non-viral nanocarrier has 4 layers:(i) the inner layer is a PLGA core;(ii) the second layer is an amphiphilic (2,3-dioleoyloxy-propyl)-trimethylammo nium (DOTAP) lipid layer coating the hydrophobic PLGA core via hydrophobic interaction;(iii) the third layer is negatively charged Cas9 mRNA layer coating the positively charged PLGA/DOTAP core;(iv) and the fourth layer is a cationic liposome incorporating the negatively charged RNA@Core (RC).So the structure of this multilayered nanocarrier is liposome@RNA@core(LRC).LRC delivers significantly more Cas9 mRNA into the cells than lipofectamine 3000 and results in higher expression of Cas9 mRNA inside the cells than lipofectamine 3000.

In addition,delivering Cas9 mRNA by LRC does not require reduced serum-culture medium as lipofectamine 3000 does.Cells grow slowly with low metabolism in reduced serum-culture medium,and some cell lines tend to die via apoptosis in the reduced serum-culture medium.LRC can deliver Cas9 mRNA in the standard complete medium for cells as efficiently as in the reduced serum-culture medium,thus avoiding changing the culture medium before transfection and applicable to cells with normal growth and metabolism in standard medium.The co-delivery of Cas9 mRNA/sgRNA via LRC elevates the gene-editing efficiency by 3 folds compared to that via lipofectamine 3000.LRC may be a good substitute of lipofectamine 3000 for delivering Cas9 mRNA/sgRNA or other RNA.

2.Materials and Methods

2.1.Materials

PLGA was from Evonik (Germany).DOTAP,dioleoyl phosphoethanolamine (DOPE),cholesterol and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000](DSPE-PEG2k) were from Avanti (USA).N,N-dimethylformamide(DMF),2,2,2-trifluoroethanol (THF),ethanol were from Sigma-Aldrich (USA).DMEM,reduced serum OPTI medium,fetal bovine serum(FBS),penicillin/streptomycin were from Gibco(USA).Phosphate buffer saline was from HyClone (USA).Water used in this research was Milli-Q (Millipore,Germany) water.

2.2.Synthesis of Cas9 mRNA

CP-C9NU-01 plasmid which contained Cas9 gene under a T7 promoter was from GeneCopoeia(USA).Restriction endonucleases SacI and XhoI(NEB,USA)were used for double digesting CP-C9NU-01 plasmid to obtain the Cas9 gene under a T7 promoter and another useless DNA fragment.The double digesting products were purified by DNA purifying columns (NEB,USA),but the two DNA fragments were not separated.The two DNA fragments,including the Cas9 gene under a T7 promoter,were transcribed with the in vitro T7 transcription kit for mRNA (NEB,USA).Cas9 mRNA was in the products and purified with the RNA purifying columns(NEB,USA)and stored at-80°C.The scramble mRNA was synthesized by Biomics Biotechnologies (China).

2.3.Electrophoresis

CP-C9NU-01 plasmid and the double digesting products were analyzed with the 2% agarose gel containing GelRed (Solarbio,China) as a fluorescence dye.The in vitro transcribed tailed and untailed Cas9 mRNA were premixed with formalin and analyzed with the 2% agarose gel containing formalin (Sigma-Aldrich,USA)and GelRed (Solarbio,China) as a fluorescence dye.DNA and RNA markers were from Life Technologies (USA).

2.4.Synthesis of cationic liposomes

DOTAP,DOPE,cholesterol and DSPE-PEG2k were dissolved in chloroform.4.4 mg DOTAP,4.7 mg DOPE,0.96 mg cholesterol and 1.7 mg DSPE-PEG2k,5 ml chloroform and 3 ml methanol were mixed in a round bottom flask(19/22,VWR,USA).Chloroform and methanol were removed via rotary evaporation at 100 r.min-1at 37 °C for 15 min.The residual lipid film was hydrated with Milli-Q water via sonication for 15 min.The products were cationic liposomes.

2.5.Synthesis of LRC

PLGA/DOTAP core was assembled in a microfluidic chip the same as reported [15].Briefly,PLGA dissolved in TFE/DMF (3/7,v/v)entered the left middle inlet at 3 ml.h-1;Milli-Q water entered the left bilateral inlets at 120 ml.h-1;DOTAP dissolved in ethanol entered the inlet at the middle of the hexane channel.The products from the outlet of the chip were PLGA/DOTAP core.1.77 μg PLGA/DOTAP core was mixed with 1 μg Cas9 mRNA via vortex for 1 min to assemble RC.After 15 min,RC was mixed with cationic liposome with various mass ratio via inversion several times.The products were LRC.

2.6.Cell culture

B16 cells,J774A.1 cells and B16 cells which expressed green fluorescence proteins (GFP) (B16/GFP cells) were cultured in DMEM medium with 10% FBS and 1% penicillin/streptomycin in the incubator (37 °C,5% CO2).

2.7.Cell transfection

Lipofectamine 3000 and LRC with 2 μg Cas9 mRNA separately were added to the culture medium of 300,000 B16 cells and J774A.1 cells.For lipofectamine 3000,the culture medium was replaced with reduced serum OPTI medium before transfection.For LRC,the culture medium was unchanged or replaced with reduced serum OPTI medium before transfection.

2.8.Q-Pcr

RNA was separated from B16 cells and J774A.1 cells with the RNA extraction kit (Life Technologies,USA).The primers for Cas9 mRNA were:forward GGAACCGCTGGAGAGCAACT;reverse GTCCCTATCGAAGGACTCTGGCA.Q-PCR was analyzed with the Q-PCR instrument (D3024R,DragonLab,China).

2.9.Western blotting

Protein was separated from B16 cells and J774A.1 cells with the protein extraction kit (Life Technologies,USA).The anti-Cas9 protein antibodies were from Abcam (USA).

2.10.Delivery of Cas9 mRNA/sgRNA for silencing the GFP gene in B16/GFP cells

The sequence of sgRNA that targets GFP gene is GGAGCGCACCATCTTCTTCAAGG.The sequence of scramble sgRNA is CAGCTGTATGATCTGGAAG.The sgRNA was synthesized by Biomics Biotechnologies (China).Cas 9 mRNA and sgRNA were premixed by 1:1(mass ratio)and loaded into LRC.3×105B16/GFP cells were cultured in complete DMEM medium (10% FBS and 1% penicillin/streptomycin).After 12 h,they were transferred into reduced serum OPTI medium that contained Cas9 mRNA/sgRNA-loaded LRC or lipofectamine 3000 (Cas 9 mRNA 1 μg,sgRNA 1 μg).After 3 days,these cells were analyzed by fluorescence-activated cell sorting (FACS,BD Accuri C6,USA).The wavelength of the laser was 488 nm,and the emission wavelength was 533 nm.

3.Results and Discussion

3.1.Synthesis of Cas9 mRNA

We obtained Cas9 mRNA from a plasmid containing a Cas9 gene under a T7 promoter (Fig.S1A).The size of the plasmid is 10 kb(kilobase).We used two restriction endonucleases to digest the plasmid into two linear DNA sequences,one of which contained the Cas9 gene under the T7 promoter (Fig.S1B).Such digesting was so efficient that we could not observe any bands for the 10 kb plasmid in the double digesting lane.Because only the gene under a T7 promoter could be transcribed into mRNA by the in intro T7 transcription kit,we did not need to purify the Cas9 gene under a T7 promoter from the two linear DNA sequences.The other linear DNA sequences without a T7 promoter could not be transcribed into the mRNA by the in vitro T7 transcription kit.When we used the two linear DNA sequences for in vitro transcription,we only observed one clear band whose size was around 4.0 kb(Fig.S1C),indicating that the transcribed products only contained Cas9 mRNA.The DNA sequences without a T7 promoter were not transcribed into mRNA.We added a poly(A)tail to the Cas9 mRNA to ensure that the Cas9 mRNA had the integral function of mRNA.The size of the tailed Cas9 mRNA was 100–200 bp(base pair)larger than the untailed Cas9 mRNA,indicating the successful tailing reaction.

Fig.1.Assembly of LRC in three steps.First,PLGA and DOTAP mix in the microfluidic channels to assemble a positively charged PLGA/DOTAP core.Second,the positively charged core mixes with the negatively charged Cas9 mRNA for 1 min and waits 15 min to attach Cas9 mRNA onto the core (RNA@Core).Third,the negatively charged RNA@Core mixes with the cationic liposome for 1 min and waits 15 min to incorporate RNA@Core into the hollow of the cationic liposome(liposome@RNA@Core).

3.2.Synthesis and characterization of LRC for delivering Cas9 mRNA

We assembled LRC layer by layer in three steps(Fig.1).We synthesized a positively charged PLGA/DOTAP hybrid nanoparticles in a microfluidic chip because the microfluidic synthesis could reproducibly provide a small PLGA/lipid core to incorporate into cationic liposomes [15].The chip has two stages:(i) three inlets and a straight mixing channel;(ii)a central inlet of the hexagon channel and a double spiral mixing channel.(i)PLGA dissolved in THF/DMF(3/7,v/v) entered the middle inlet in the first stage of the chip at 3 ml.h-1;(ii)the water entered the bilateral inlets in the first stage of the chip at 120 ml.h-1for each inlet;(iii) DOTAP dissolved in ethanol entered the central inlet of the hexagon channel at 3 ml.h-1.Amphiphilic DOTAP coated onto the hydrophobic PLGA core by hydrophobic interaction via vigorous mixing in the channels.The average size of the PLGA/DOTAP core was～97 nm,and the zeta potential was～52 mV (Fig.2) according to the results of dynamic laser scattering (DLS).We mixed the negatively charged Cas9 mRNA with the positively charged core to attach Cas9 mRNA onto the positively charged surface of the core via electrostatic interaction.The zeta potential of the compound was～–33 mV(Fig.2C),indicating the successful attachment of Cas9 mRNA onto the surface of the positively charged core.The average size and the polymer dispersity index (PDI) of RC was similar to the core(Fig.2A,B),indicating that the attachment of Cas9 mRNA did not cause aggregation of the compound.We mixed the negatively charged RC with the cationic liposome to incorporate RC into the cationic liposome via electrostatic interaction.The zeta potential of LRC increased and maintained at a stable level that is similar to the zeta potential of cationic liposome with the increase of the mass ratio of LRC (Fig.2D).When the liposome/RC was low,the zeta potential of the products was the average of the positively charged liposome entrapping RC and the negatively charged free RC,so the zeta potential increased with the increase of the mass ratio of liposome/RC.When the liposome/RC was high,all RC was incorporated into the cationic liposome,so the products were the mixture of liposome and LRC and exhibited the zeta potential of the cationic liposome.So we could obtain the optimal mass ratio of liposome/RC(9)when the zeta potential did not increase significantly with the increase of the mass ratio of liposome/RC.When the mass ratio of liposome/RC was 9,the average size,PDI and zeta potential of LRC were similar to those of the cationic liposome(Fig.2),the products were LRC,but not the mixture of liposome and RC.LRC has PLGA/DOTAP core inside,Cas9 mRNA in the middle layer,and liposome in the outside shell to protect the Cas9 mRNA from digesting by RNase.

Fig.2.Size distribution and zeta potential of the cationic liposome,PLGA/DOTAP core,RC and LRC.(A)Size distribution,(B)PDI and(C)zeta potential of the cationic liposome,PLGA/DOTAP core,RC and LRC measured by DLS.(D)Zeta potential of LRC with a various mass ratio of cationic liposome/RC measured by DLS.

3.3.LRC delivers Cas9 mRNA into cells more efficiently than lipofectamine 3000

We compared the delivery and transfection efficiency of Cas9 mRNA by LRC and lipofectamine 3000 in two murine cell lines,B16 cells (mouse melanoma cell line) and J774A.1 cells (mouse monocyte macrophages).Lipofectamine 3000 required reduced serum OPTI medium to transfect the cells,so we compared the delivery and transfection efficiency of Cas9 mRNA via LRC and lipofectamine 3000 in reduced serum OPTI medium.In reduced serum OPTI medium,Cas9 mRNA in both B16 cells and J774A.1 cells transfected by LRC and lipofectamine 3000 reduced continuously from 24 h to 72 h post-transfection (Fig.3),because RNase in the cells could digest Cas9 mRNA.Cas9 mRNA in LRC entered the cells over 2 times more efficiently than that in lipofectamine 3000(Fig.3),because LRC had a rigid PLGA core and thus was more rigid than hollow lipofectamine 3000.Rigid nanoparticles entered the cells much more efficiently than the less rigid ones[15].The higher amount of Cas9 mRNA in both B16 cells and J774A.1 cells transfected by LRC resulted in the over 5 times more expression of Cas9 protein than lipofectamine 3000 (Fig.4,S2).

Fig.3.The relative content of Cas9 mRNA in B16 cells and J774A.1 cells transfected by lipofectamine 3000 and LRC.(A)The relative content of Cas9 mRNA in B16 cells transfected by lipofectamine 3000 in reduced serum OPTI medium and LRC in reduced serum OPTI medium and standard complete medium.(B) The relative content of Cas9 mRNA in J774A.1 cells transfected by lipofectamine 3000 in reduced serum OPTI medium and LRC in reduced serum OPTI medium and standard complete medium.scRNA,scramble mRNA.

Fig.4.Expression of Cas9 protein in B16 cells and J774A.1 cells transfected by lipofectamine 3000 and LRC.(A) Western blotting of Cas9 protein and actin (as a control protein) in B16 cells transfected by lipofectamine 3000 in reduced serum OPTI medium and LRC in reduced serum OPTI medium and standard complete medium.(B)Western blotting of Cas9 protein and actin in J774A.1 cells transfected by lipofectamine 3000 in reduced serum OPTI medium and LRC in reduced serum OPTI medium and standard complete medium.(C)Cas9/actin grayscale ratio in (A)for B16 cells.(D) Cas9/actin grayscale ratio in (B) for J774A.1 cells.

We checked if LRC could transfect the B16 cells and J774A.1 cells in standard complete medium (containing 10% FBS).Because the cellular viability and cellular metabolism were abnormal in reduced serum medium,we wished to evaluate the possibility of using LRC to transfect Cas9 mRNA in complete medium.For transfection of B16 cells and J774A.1 cells via LRC,standard complete medium reduced the entry of Cas9 mRNA into cells (Fig.3) but increased the expression of Cas9 mRNA (Fig.4,S2) by over 3 folds compared to reduced serum OPTI medium.Because on the one hand,the complete medium contains more serum proteins than reduced serum OPTI medium,and some of these negatively charged serum proteins can attach onto the positively charged LRC and reduce the surface charge of LRC.Nanocarriers with low zeta potential usually enter the cells less efficiently than that with high zeta potential because the cell membrane is negatively charged [16].On the other hand,most cells in complete medium survive better and synthesize proteins (including Cas9 protein here) more efficiently than that in reduced serum OPTI medium.The entry of Cas9 mRNA on LRC into B16 cells and J774A.1 cells in the complete medium was comparable to that on lipofectamine 3000 in reduced serum OPTI medium (Fig.3).Still,the expression of Cas9 mRNA on LRC in the complete medium was over 15 times more than that on lipofectamine 3000 in reduced serum OPTI medium(Fig.4,S2).Both LRC and complete medium contributed to the significantly enhanced expression of Cas9 mRNA compared to lipofectamine 3000 in reduced serum OPTI medium.LRC may be a good alternative of lipofectamine 3000 for delivering Cas9 mRNA efficiently without changing the culture medium from standard complete medium to reduced serum OPTI medium.

3.4.LRC delivers Cas9 mRNA/sgRNA for elevating the gene editing efficiency

We compared the gene-editing efficiency of Cas9 mRNA&sgRNA delivered via LRC and lipofectamine 3000.We devised a sgRNA sequence that targeted GFP gene in B16/GFP cells and called the sgRNA sgGFP.We cultured B16/GFP cells in standard complete medium and transferred them into the reduced serum medium that contained Cas9 mRNA&sgGFP-loaded LRC or lipofectamine 3000.The FACS analysis showed that Cas9 mRNA&sgGFP-loaded lipofectamine 3000 silenced the expression of GFP in around 10%B16/GFP cells (Fig.5A,B),while Cas9 mRNA&sgGFP-loaded LRC silenced the expression of GFP in around 30% B16/GFP cells(Fig.5A,C).LRC increased the GFP gene editing efficiency by 3 folds compared to lipofectamine 3000 (Fig.5A–D).Because LRC had enhanced delivery efficiency and expression of Cas9 mRNA than lipofectamine 3000.When delivering Cas 9 mRNA and scramble sgRNA,neither lipofectamine 3000 nor LRC caused any silencing of GFP expression in the B16/GFP cells(Fig.S3).These experiments demonstrated that the delivery of Cas9 mRNA/sgRNA via LRC had more efficient gene-editing efficiency than that via lipofectamine 3000.

Fig.5.The fluorescence distribution of B16/GFP cells cultured with lipofectamine 3000 and LRC which load Cas9 mRNA and sgGFP.(A) GFP fluorescence distribution of 10,000 untreated B16/GFP cells.(B)GFP fluorescence distribution of 10,000 B16/GFP cells cultured with lipofectamine 3000.(C)GFP fluorescence distribution of 10,000 B16/GFP cells cultured with LRC.(D)The geometry mean fluorescence intensity of 10,000 untreated B16/GFP cells and 10,000 B16/GFP cells cultured with lipofectamine 3000 or LRC.

4.Conclusions

We assembled the multilayered nanocarriers,LRC,to incorporate Cas9 mRNA/sgRNA inside for protection of the vulnerable RNA.LRC could achieve more efficient transfection than commercial lipofectamine 3000 in both reduced serum OPTI medium and standard complete medium.Given the high transfection efficiency of Cas9 mRNA/sgGFP,LRC may be a good substitute for lipofectamine 3000 to deliver Cas9 mRNA/sgRNA and other types of nucleic acids with high efficiency.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

Xuanyu Li,Qiang Feng and Ziwei Han contributed equally to this work.We thank the National Natural Science Foundation of China (21761142006,21535001,and 81730051),Shenzhen Science and Technology Program (KQTD20190929172743294),the National Key R&D Program of China (2018YFA0902600),the Chinese Academy of Sciences (QYZDJ-SSW-SLH039),Shenzhen Bay Laboratory (SZBL2019062801004),Tencent Foundation through the XPLORER PRIZE for financial support.

Supplementary Mateiral

Supplementary data to this article can be found online at https://doi.org/10.1016/j.cjche.2021.02.009.