Inhibitory Effects of AURKB Gene on Apoptosis and Cancer Cell Growth in HCT 116

Wangyuan ZENG1Δ, Wenxin DAI

1. Department of General Medicine, the First Affiliated Hospital of Hainan Medical College, Haikou 570102, China; 2. Department of BIN Convergence Technology and Polymer Nano Science and Technology, Chonbuk National University, 664-14, Dukjin, Jeonju 561-756, Korea

Abstract [Objectives] To explore the inhibitory effect of AURKB gene in apoptosis and cancer cell growth in HCT 116 cells. [Methods] The in vitro cytology studies were carried out to confirm the expression of the AURKB gene in HCT 116 cells and make clear its role in cell activity, cell cycle control and apoptosis, and investigate the effect of AURKB gene in colorectal cancer (CRC). Quantitative reverse transcription/polymerase chain reaction (PCR) analysis and immunofluorescence (IF) staining for markers of AURKB gene were used to examine the effect of AURKB on HCT 116. The AURKB gene target was examined using western blot analysis. In addition, inhibition of AURKB expression was examined using RNA interference (RNAi) on HCT 116 cells in vitro. [Results] HCT 116 cells infected with AURKB shRNA virus suppressed expression of AURKB in vitro. AURKB gene knockdown HCT 116 cells showed reducing cell apoptosis in vitro. Finally, it demonstrated that AURKB function can induce apoptosis of HCT cells. [Conclusions] AURKB is a key regulator of colorectal cancer. AURKs are potential novel molecular targets for the prevention of cancer cell proliferation.

Key words Colorectal cancer, AURKB, Apoptosis, Cell growth

1 Introduction

Colorectal cancer (CRC), as one of the most common malignant tumor, affects people worldwide[1-2]and is the second most frequent cause of cancer mortality[3]and the third most common cancer worldwide[4]. CRC, also known as bowel cancer and colon cancer, is the development of cancer from the colon or rectum. A cancer is the abnormal growth of cells that can invade or spread to other parts of the body. Nevertheless, less than 30% of cancer patients survive for over five years after surgery[5]. CRC patients are at increased risk of second cancer, apart from their risk of recurrence of the original cancer. CRC is a curable disease if the growth is detected at an early stage. At advanced stage, metastasis is responsible for the poor prognosis of CRC. However, the exact mechanism underlying CRC remains enigmatic. Considering the significant morbidity and mortality risk, there is an urgent need for better prognostic biomarkers. CRC is characterized by frequent chromosomal abnormalities including translocations, gains, and losses of chromosomes or their segments. Chromosomal instability promotes carcinogenesis through loss of tumor suppressors and copy number gains of oncogenes. Causes of CRC are still poorly understood but possibly include mitotic spindle checkpoint gene deregulation, cycle regulator, and abnormal centrosome number and function. Centrosome dysfunction causes abnormal centrosome segregation during mitosis, which may lead to CRC.

The aurora kinases that are frequently upregulated in human cancers constitute one family of serine/threonine kinases whose activity is essential for mitotic progression. AURKs are important molecules involved in mitosis, and AURKB has been shown to be overexpressed in several types of cancer, however, it has not been reported in colorectal cancer. The role of AURKB gene in CRC remained heretofore unexplored.

AURKB (Aurora Kinase B) is a serine/threonine kinase better known for its role at the mitotic kinetochore, in a cell-cycle regulated manner, during chromosome segregation. The AURKB gene has been recognized as an important tumor suppressor gene due to its functions in mitosis. Throughinvitrocytology studies, we confirmed that the AURKB gene is abundantly expressed in HCT 116 cells, and studied its role in cell activity, cell cycle control and apoptosis. Aurora kinases control cell cycle progression[6]. AURKB is a cell cycle-regulated kinase involved in spindle formation and chromosome segregation for proper mitotic progression. AURKB is a member of the Aurora kinase subfamily of conserved serine/threonine kinases[7]. AURKB is important in both normal and cancerous cell division[8]. AURKB starts at early G2 and localizes at the centromere till metaphase and then moves to the midzone and midbody until the end of cytokinesis. It plays a key role during mitosis by regulating chromosomal alignment, segregation, and cytokinesis, as the catalytic protein of the chromosomal passenger complex (CPC)[9]. AURKB appears in the nucleus at the initial synthesis phase and is involved in the regulation of cytokinesis by binding to several proteins containing the inhibitor surviving[10-11]. AURKB is a kinase targeting histon-3. In the mitosis process, it phosphorylates histone H3, histone phosphorylation plays a fundamental and basic role. AURKB phosphorylates Ser10 (H3-s10ph)[12]. The phosphorylation of these two residues in H3 occurs in interphase, and in early mitotic cells when they are required for chromosome compaction[13].

But till now, no study has comprehensively examined the role of AURKB in CRC. In our study, we first demonstrated that AURKB gene is associated with the cell activity and apoptotic in colorectal cancer cells. In this study, we established knockdown URKB cells from two CRC cell lines with different metastatic potential, the human colorectal cancer cell line (HCT 116), with AURKB specific siRNA lentivirus, were used to investigate the possibility of AURKB gene mediated cell activity and apoptosis in CRC. The HCT 116 cell line was derived from human colorectal cancer cells. Cell viability, cell virus infection, apoptosis, cell cycle phase, and caspase 3/7 activation were analyzed. Target cell without virus infection as the negative blank control. Our current data support AURKB as a potential contributing factor for AURKB in CRC.

In the present study, we investigated the effects of AURKB gene in CRC. Quantitative reverse transcription/polymerase chain reaction (PCR) analysis and immunofluorescence (IF) staining for markers of AURKB gene were used to examine the effect of AURKB on HCT 116 cells. The AURKB gene target was examined using western blot analysis. In addition, inhibition of AURKB expression was examined using RNA interference (RNAi) on HCT 116 cellsinvitro. HCT 116 cells infected with AURKB shRNA virus suppressed expression of AURKBinvitro. AURKB gene knockdown HCT 116 cells showed reducing cell apoptosisinvitro. Here, we demonstrated that AURKB function can induced apoptosis of HCT 116 cells. The results of the present study demonstrated that AURKB is a key regulator of CRC. AURKB can become a novel treatment target site. Therefore, AURKs are potential novel molecular targets for the prevention of cancer proliferation, and clinical trials have been performed.

2 Materials and methods

2.1 Cell cultureHuman colorectal cancer cell line (HCT 116, Caco-2), human colon cancer cell line (RKO, SW480, SW620), human colon adenocarcinoma lung metastasis cell line T 84, and human colorectal adenocarcinoma epithelial cell line DLD-1 were purchased from Cell Bank of Chinese Academy of Sciences (Shanghai, China). The cells were cultured in RPMI-1640 supplemented with 10% heat-inactivated fetal bovine serum, sodium pyruvate, non-essential amino acids, and streptomycin in a humidified incubator with 5% CO2at 37 ℃.

2.2 Vector construction and transfectionThe GFP plasmid was transfected into HCT 116 cell line to establish HCT 116/GFP+cell line. We transfected HCT 116 cell lines, HCT 116/GFP+with AURKB specific RNAi lentiviral vectors (lentiviral small interfering RNA (siRNA) specific for human AURKB vectors) as well as Negative controls (group NC). AURKB silenced cells were screened by puromycin (Clontech, Japan). Quantitative RT-PCR and Western blot analysis were used to detect the expressions of AURKB mRNA and protein, respectively. The lentivirus transfection procedure was performed as per manufacture manual. The three target sequences were: 5′-CCAAACTGCTCAGGCATAA-3′, 5′-GCACAATGAGAAGGTGGAT -3′ and 5′-CCTTTGAGAGTGCATCACA-3′.

2.3 Primer design, transfection, and RT-PCRA nonsynonymous A/G (Trp/Arg) polymorphism in exon 3 (nt 305 of NM_206956) generates a natural FauI RFLP with the G (CCCGC) but not the A (CCCAC) allele cleaved by the restriction enzyme. DNA (5′ caggaggccgttgcttcgta and 5′ cgtctactgtgagggacctc) and cDNA specific (5′ cagtgcagatgatgaacatgg and 5′ ctgccagctccacaagtctc) primers were used in PCR/RT-PCR reactions with the conditions described and digests carried out using 0.6 enzyme units/reaction at 55 ℃ for 5 h. AI and AEI were scored as for SERPINB5.

Total RNA was extracted using Trizol reagent (Shanghai Pufei Biotech Co., Ltd, China) and was employed to generate cDNA using Superscript III RT (Invitrogen Corp., USA) Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT, Promega, USA) and an oligo (dT) primer (Shanghai Sangon Biotech, China).

For RT-PCR studies, total RNA from HCT 116 cell lines was extracted with the Trizol reagent according to the manufacturer’s instructions, and One microgram RNA was reversely transcribed into cDNA using AMV reverse transcriptase by reverse transcribing the total 500 ng RNA with a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT, Promega, USA). GAPDH was used as an internal control, and gene values were normalized to GAPDH. Real-time PCR was performed using a Roche Light Cycler480 Real-Time PCR System (Roche Life Science, Shanghai, China) on an ABI 7300 PCR system (Applied Biosystems). qPCR was performed using LightCycler®480 sybr Green I Master (Roche, USA) according to the manufacturer’s protocol. Three biological replicates were used for quantification analysis, and three technical replicates were analyzed for each biological replicate. GAPDH was used as an internal control for normalization. The reverse transcription primer was bought from Rubo (Rubo Biotechnology Co., Ltd., China). The primers used for experimental gene were as follows. AURKB gene: forward: CAGAAGAGCTGCACATTTGACG, reverse: CCTTGAGCCCTAAGA-GCAGATTT, Amplified fragment size (bp): 136; CDCA8 gene: forward: GCAGGAGAGCGGATTTACAAC, reverse: CTGGGC-AATACTGTGCCTCTG, Amplified fragment size(bp):141; GAPDH: forward: TGACTTCAACAGCGACACCCA, reverse: CACCCTGTTGCTGTAGCCAAA, Amplified fragment size (bp): 121, was used as an internal control. All reactions were performed in triplicate. Data were analyzed using the 2-ΔΔCt method[14-15]to obtain relative abundance.

2.4 Cell counting Kit-8(CCK8) assayCell proliferation assays were performed with a Cell Counting Kit-8 (CCK-8; Sigma, German), HCT 116 cells were plated in 96-well plates in triplicate at 2.0×103per well. Cell viability was determined at 24-120 h after splitting. Then cells were treated with pcDNA-MEG3 and the number of cells per well was measured by the absorbance (450 nm) of reduced WST-8 (2-(2-methoxy-4-nitrophenyl) -3-(4-nitrophenyl) -5-(2,4-isulfophen-yl) -2H-tetrazolium, monosodium salt) at the indicated time points.

2.5 Detection of apoptosis by flow cytometryCell apoptosis was detected using Annexin V-APC apoptosis detection kit (eBioscience 88-8007, USA), following the manufacturer’s protocol. In brief, HTC 116 cells were seeded in 6-well plates at the concentration of 1×105cells/well in 2 mL medium. The cells were passaged third days after infection, and the fusion degree reached 85% at fifth days. The supernatant was discarded after centrifugation for 5 min at 1 300 rmp. The cells were washed with precooled (at 4 ℃) D-Hanka (pH=7.2-7.4). 1×binding buffer washed cells were precipitated once, 1 300 RMP and 3 min centrifugated, and cells were collected. 200 μL 1×binding buffer suspension cell precipitation. HCT 116 apoptosis cells were harvested, washed with PBS, and resuspended in staining buffer at a density of 1×106cells/mL. After washing with PBS, cells were stained with 10 μL Annexin V-APC at room temperature avoiding light for 10-15 min. Samples were observed by inverted fluorescence microscope (OLYMPUS, Japan). HCT 116 cells were divided 3 groups: group KD (target cells with AURKB specific small interfering RNA (siRNA) lentiviral vectors), group NC (target cells with AURKB negative control siRNA lentiviral vectors) and group CON (target cells without lentiviral vectors infection).

2.6 Cell cycle assayFor cell cycle detection, the cells were washed once with phosphate-buffered saline (PBS) and adjusted to 1×106/mL after centrifugation. Cells were fixed with 70% ethanol and preserved at 4 ℃ for 4 h. Fixed cells were then added 100 μL of RNase A and stored in a water bath for 30 min. Later, 400 μL Propidium (PI) (Sigma, China) was added to stain the cells for 30 min at 4 ℃ in the dark. Flow cytometry (Millipore, German) was used to determine the cell cycle distribution. PI staining was performed to analyze the cell cycle. PI absorbance was determined on a flow cytometry.

2.7 Caspase 3/7 assayCells were harvested and seeded in 96-well plates (1 500 cells per well) and incubated at 37 ℃ for lentivirus infection in CO2incubator. 48 h later, cell viability was determined at 96 h. The caspase 3/7 activity was test by the measurement of caspase 3/7 assay with Caspase-Glo®3/7 Assay kit (Promega, USA) according to the manufacturer’s instructions, caspase 3/7 working solution was added (100 μL per well). At the same time, a set of blank control cells containing only cells (only 100 μL per well of medium was added) was set. The cell-added culture plate was placed on a shaker and gently shaken at 300-500 rpm for 30 min to mix. It is then incubated at room temperature (18-22 ℃) for 1-3 h depending on the cell condition. Measure the luminescence of each sample in plate-reading luminometer as directed by the luminometer manufacture. The luminescence of the samples was measured using fluorescence microscope (OLYMPUS, Japan). The experiment was performed using 3 replicates. The data were used for analysis. Groups were compared byttest, whenP<0.05, it means statistically significant difference.

2.8 Cell colony formation assayA single cell lasts for more than 6 generationsinvitro, and the cell population composed of its progeny is called a clone. Cells were plated in 6-well plates at 1 000 per well and maintained in a medium containing 10% phosphate buffered saline (FBS) in duplicate for each group. Cells were incubated at 37 ℃ and 5% CO2for 7-14 d. After 3 d of infection, the seed plate was cultured for 10 d and the liquid was changed every 3 d. Then, the cells were washed twice with PBS, fixed with methanol for 20 min and then stained with Giemsa staining solution. Colonies were visualized by crystal violet staining. The number of colonies containing ≥50 cells were counted under a microscope. By counting the colony formation rate, the proliferation potential of individual cells can be quantitatively analyzed to understand the cell proliferation ability and independent viability. All these experiments were performed in triplicates. Colony forming efficiency was calculated using the following formula: Percentage of colonies (%)=Number of colonies formed/Number of cells inoculated×100%. Survival was calculated by pooling all data of the different inoculum’s levels for each individual experiment. Plating efficiency (PE) was calculated according to the formula:

PE=No.of colonies/No.of cells seeded×100%

The surviving fraction after irradiation is then calculated as follows:

S=No.of colonies/No.of cells seeded×PE

Cell inactivation and dose modifying parameters were obtained as for the CV cell proliferation assay.

2.9 Western blottingHCT 116 cells infected with lentivirus were washed with PBS and resuspended in ice-cold RIPA lysis buffer supplemented with protease inhibitor cocktail. The lysate was incubated on ice for 30 min then centrifuged at max speed for 10 min at 4 ℃. Equal concentration of protein lysate was separated by SDS-PAGE on a 4%-15% gradient gel then subsequently transferred to nitrocellulose membrane. After transfer, the membrane was blocked with Odyssey blocking buffer (LI-COR Biosciences Lincoln, NE) for 1 h at RT, then incubated in primary antibody diluted in Odyssey blocking buffer in 0.1% Tween-20 overnight at 4 ℃. After washing three times in PBST, the membrane was then incubated in IRDye conjugated secondary antibody (LI-COR Biosciences, Lincoln, NE, USA) for 1 h at RT. The membrane was scanned on the Odyssey infrared imaging system.

Antibody pretest: AURKB

Primary antibody was: mouse anti-AURKB (1∶500, Santa Cruz, Holy Cross, Spanish). Second antibodies were: rabbit IgG (1∶5 000, Santa Cruz, Holy Cross, Spanish), mouse IgG (1∶5 000, Santa Cruz, Holy Cross, Spanish).

2.10 Statistical analysisAll experiments were repeated at least three times unless otherwise noted. Data were presented as mean±standard deviation and analyzed via one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison. Data analysis and plotting were conducted in GraphPad Prism 4.0 (GraphPad software, San Diego, CA, United States). Clinical data were analyzed via SPSS 22.0 software (Chicago, IL, United States). The association between MYCT1 expression and age/gender was analyzed via Pearson’s chi-square test. The association between MYCT1 expression and French-American-British (FAB) category was analyzed via likelihood ratio chi-square test (this test was used when there were groups with count less than five). WhenP<0.05, it means statistically significant difference.

3 Results

3.1 AURKB gene overexpression in CRC cellsHuman colorectal cancer cell line (HCT 116, Caco-2), human colon cancer cell line (RKO, SW480, SW620), human colon adenocarcinoma lung metastasis cell line T84, and human colorectal adenocarcinoma epithelial cell line DLD-1 were cultured in RPMI-1640 supplemented with 10% fetal calf serum, 5% CO2at 37 ℃. The results showed that each cell line grew well in the respective medium. The reference gene and the target gene primer were designed and synthesized by the Genechem. Co,. Ltd. The primer information is listed in Table 1. Amplification curve, amplification product melting curve, 2-ΔΔCTmethod data analysis were showed in Fig.1 and Table 2.ΔCT equals CTvalue of reference gene from CTvalue of target gene.

When the value ofΔCT is less than 12, it represents the gene expression abundance in this cell is high. When the value ofΔCTis greater than 12 and below than 16, represent the gene expression abundance in this cell is medium. When the value ofΔCTis greater than 16, the abundance of gene expression in this cell is low. Our data showed that AURKB expression was significantly higher in T84, RKO, DLD-1, HCT 116, Caco-2, SW480, SW620 (Fig.1 and Table 2). We selected HCT 116 cells as target cells, and the AURKB gene was used as a follow-up study in this experiment.

Table 1 The primer information

Gene nameUpstream primer sequenceDownstream primer sequenceAmplified fragment size∥bpGAPDHTGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA121MELKTATTCACCTCGATGATGATTGCGAGAAAGCCTTAAACGAACTGGTT169CPT2CCTGGTCAATGCGTATCCCGCCCAGATGTCTCGGTTCT285CDCA8GCAGGAGAGCGGATTTACAACCTGGGCAATACTGTGCCTCTG141AURKBCAGAAGAGCTGCACATTTGACGCCTTGAGCCCTAAGAGCAGATTT136NDE1TCAGTCCCCAAACCGAACATATCACCCAAAGGCACGCT104

Note: GAPDH is internal reference, others are target genes.

Table 2 The data of 2-ΔΔCtmethod

CellnameMEANGAPDHMeanAURKBMeanΔCTInternalreference geneTargetgeneT8413.28020.5937.3130.3100.040DLD-113.70320.5536.8500.1500.420RKO13.64719.7936.1470.1100.220HCT 11613.06320.3937.3300.1500.160Caco-213.17720.5477.3700.1500.240SW48013.35019.2975.9470.1500.410SW62014.00319.9804.9770.1700.380

3.2 Expression abundance and the knockdown rate in each group with viral infectionThe GFP plasmid was transfected into HCT 116 cell line to establish HCT 116/GFP+cell line and/GFP+cell line. We transfected HCT 116 cell lines, HCT 116/GFP+with AURKB specific small interfering RNA (siRNA) lentiviral vectors (group KD, according to the infected virus, it is divided into KD1, KD2, KD3 groups) and with AURKB negative control siRNA lentiviral vectors (group NC). HCT116 cells without lentiviral vectors infection used as control group (group CON). After transfection of HCT 116 cells with AURKB-specific(group KD), AURKB-negative control lentiviral vector (group NC) and HCT 116 without viral vector (group CON) for 48 h, some cells showed green fluorescence under fluorescence microscope (×100) (Fig.2A). This indicates that HCT 116 cells package AURKB specific lentiviral vector and AURKB negative control lentiviral vector. The lentiviral vector plasmid was obtained successfully, and the collected virus particles were recombinant AURKB specific gene and AURKB negative RNAi lentiviral particles. The lentiviral vector plasmid was obtained successfully, and the collected virus particles were recombinant AURKB specific gene and AURKB negative RNAi lentiviral particles.

The cells were in good condition and there was no significant death, especially in the NC group. In general, downstream infections can be continued if the cell infection efficiency is above 70%. Our cell infection efficiency (Fig.2B) is above 80%; From our results (Fig.2C and Fig.2D) of quantitative PCR, it can be seen that: the knockdown rate of AURKB gene in KD1, KD2 and KD3 groups were 88.7%,64%, 84.2%, respectively, relative to NC group. The cell infection efficiency and the knockdown rate are the highest in three interfered groups AURKB specific RNAi lentiviral vectors, so we selected group KD1 as knock down AURKB group (group KD) to conduct experiment. The results of viral infection, the expression abundance and the knockdown rate shown in Fig.2.

3.3 Lentivirus-mediated silencing of AURKB gene in HCT 116 cell lineTo understand the effects of AURKB in CRC, we performed AURKB specific siRNA interference lentivirus in HCT 116 cells which have been shown to have a higher expression of AURKB (Fig.3A-D). To further understand the effects of AURKB in CRC, we performed qRT-PCR and western blotting methods in HCT 116 cells. Compared with the cells in group CON and the group NC, respectively, AURKB specific siRNA transfected cells (the group KD) got declining level of AURKB expression (Fig.3E). To assess the effects of knockdown on gene expression, theΔΔCTvalue was calculated for each gene of interest by subtracting theΔCTvalue for without interfered cells from theΔCTvalue for interfered cells (ΔΔCT=ΔCTinterfered-ΔCTwithout interfered). Target genes are from a human apoptosis array. PositiveΔΔCTvalues indicate downregulation; negativeΔΔCTvalues indicate upregulation. MeanΔΔCTvalues is the expression abundance value. The gene knockdown rate is equal to 1 minus the meanΔΔCTvalues. Results were expressed as fold changes compared to negative control. TheΔΔCTvalue was calculated for each gene of interest by subtracting theΔCTvalue for without interfered cells from theΔCTvalue for interfered cells (ΔΔCT=ΔCTinterfered-ΔCT

Fig.1 Amplification curve and melting peaks

Note: A. Bright field and green fluorescent field images (original magnification: 100×) of enhanced green fluorescent protein expression in HCT 116 cells transfected with AURKB specific RNAi lentiviral vectors. B. Statistical data. C. The cell infection efficiency in group KD1, group KD2 and group KD3 (KD: group HCT 116 cells with AURKB specific siRNA lentiviral vector, according to the infected virus, it is divided into KD1, KD2, KD3 groups; NC: group HCT 116 cells with AURKB negative control siRNA lentiviral vectors; CON: group HCT 116 cells without lentiviral vectors infection). D. The knockdown rate of AURKB gene in KD1, KD2, and KD3 groups compared with NC group.

Fig.2 Infection of HCT 116 cells

without interfered). Target genes are from a human apoptosis array. PositiveΔΔCTvalues indicate downregulation, while negativeΔΔCTvalues indicate upregulation. Data are shown in Fig.3F. Our results showed that Lentivirus-mediated silencing of AURKB gene in HCT 116 cell line was successful.

3.4 Effects of AURKB on cell proliferation and cell viability in HCT 116 cellsTo study the role of AURKB in cells growth or proliferation, the HCT 116 cells were analyzed by CCK8 assay. CCK-8 allows sensitive colorimetric assays for the determination of cell viability in cell proliferation and cytotoxicity assays. Dojindo’s highly water-soluble tetrazolium salt, WST-8, is reduced by dehydrogenase activities in cells to give a yellow-colour formazan dye, which is soluble in the tissue culture media. The amount of the formazan dye, generated by the activities of dehydrogenases in cells, is directly proportional to the number of living cells. The detection sensitivity of CCK-8 is higher than the other tetrazolium salts such as MTT, XTT, MTS or WST-1. Knockdown AURKB (the group KD) significantly inhibited HCT 116 cells growth of day 4 and day 5 compared with the group CON and the group NC, respectively (Fig.4). Meanwhile, our data showed that knockdown AURKB promoted HCT 116 cells apoptosis. These data suggest that AURKB positive regulates CRC cells growth.

3.5 Effects of AURKB on the apoptosis of HCT 116 cellsTo demonstrate that AURKB induces apoptosis, we conducted apoptosis in CRC cells. Apoptosis assay was conducted and the cell proportions in naked, live or intact, apoptotic were quantitated using flow cytometry. Decreased cell proliferation induced by AURKB knockdown may be a consequence of increased cell death. Thus, we analyzed the apoptosis in HCT 116 cells. We found that the cells of group KD had higher percentages of apoptotic cell number compared with the group CON and the group NC (Fig.5). Consistently, the apoptosis and caspase-3/caspase-7 activity was both enhanced in the cells of group KD compared with the group CON and the group NC, respectively.

Notes: A. Amplification curves; B. In HCT 116 cells: it shows the histogram of the relative mRNA level in the group NC and the group KD by RT-PCR; C. Melting peaks; D. Bright field and green fluorescent field images (original magnification: 100×) of enhanced green fluorescent protein expression in HCT 116 cells transfected with AURKB specific RNAi lentiviral vectors. B and N represent bright field and green fluorescent field, respectively; E. Western blot analysis of AURKB in HCT 116 cells expression in each group. Primary antibody: AURKB (1∶5 000), secondary antibody: Rabbit (1∶70 00); F. Data of RT-PCR; KD: group HCT 116 cells with AURKB specific small interfering RNA (siRNA) lentiviral vectors; NC: group HCT 116 cells with AURKB negative control siRNA lentiviral vectors; CON: group HCT 116 cells without lentiviral infection.

Fig.3 Infection of HCT 116 cell line

Notes: In HCT 116 cells, the change of multiples of the light absorption rate of the wavelength 450 nm that is determined by enzyme labelling instrument at different experimental groups was compared with time.OD450reflects the number of viable cells. Transfection of HCT 116 cells KD, the results showed that the cell growth in HCT 116 knockdown groups was slower during 0-120 h, compared to CON, NC, respectively (t-test,P<0.05). The results show data from at least three independent experiments, expressed as the mean±SD.*P<0.05.

Fig.4 Cell viability by CCK8 assay

3.6 Effects of AURKB knockdown on the cell cycle arrest of HCT 116 cellsNormal cell proliferation is regulated by the cell cycle, while tumor cells are regulated by changes in the cell cycle, so tumors are also considered to be cyclical diseases. Because cell cycle is the primary event of cell proliferation, we first focused on whether AURKB regulated the progression of cell cycle. PI staining detected by flowmetry was performed in HCT 116 cells. PI is an insertion nucleic acid fluorescent dye that can selectively intercalate between the bases of nucleic acid DNA or RNA double-stranded helix to produce red fluorescence, and the fluorescence intensity is proportional to the amount of nucleic acid embedded. In the cell cycle assay, RNase A (Fermentas, Canada) is first used to exclude the effects of RNA digestion. We investigated the impact of HCT 116 cell lines, ARUKB+/target cells, AURKB-/target cells and target cells without infected virus, on cell cycle by flow cytometry. The fluorescence intensity of PI is directly reflected the DNA distribution of each phase of the cells by flow cytometry (Millipore, German) (Fig.5A) and cell-

Notes: A. Apoptosis of HCT 116 cells determined by Annexin V-APC staining and flow cytometry in each group. Red-R fluorescence upper right and lower right of quadrants of the panels represented apoptotic cell area. B. Analysis of cell apoptosis. Independent experiments with three replicates in each,n=3;*P-value, CON compared with the KD,P<0.01;**P-value, NC compared with the KD,P<0.05, bars indicate mean±SD. C. The percentage of different cell population was tested by flow cytometry. The results were expressed as the mean±SD of independent experiments. KD: target cells with AURKB specific small interfering RNA (siRNA) lentiviral vectors group, NC: target cells with AURKB negative control siRNA lentiviral vectors group, CON: Target cells without lentiviral vectors infection group.

Fig.5 Apoptosis of HCT 116 cells

Notes: A. The total number of cells in each group was compared in Yellow-B fluorescence Area (YEL-B-ALin). B. Phase percentage of cells in each group was compared. C.t-test of cell cycle data in each group was compared. Independent experiments with three replicates in each group,n=3;*P-value, CON compared with the KD,P<0.01;**P-value, NC compared with the KD,P<0.05, bars indicate means with SD. Our results showed that AURKB knockdown resulted in creased distribution in G0/G1phase and decreased distribution in S, G2/M phases.

Fig.6 Cell cycle of HCT 116 cell line

cycle analysis (Fig.5B and Fig.5C), thereby calculating the percentage of each phase. As expected, the number of PI-positive was significantly decreased in group KD compared to group CON and group NC, respectively. Compared with the group NC and the group CON, respectively, the proportion of cells in the G0/G1phase of the group KD was significantly increased (P<0.001 byt-test analysis), and the proportion of cells in the S and G2/M phases was decreased, the difference was statistically significant (Sphase,P<0.001 byt-test analysis; G2/M phase:P<0.05 byt-test analysis). Compared with the group NC and the group CON, respectively, the proportion of cells in the G0/G1phase of the group KD was significantly increased (P<0.001 byt-test analysis) and the proportion of cells in the S phase was decreased (P<0.001 byt-test analysis), the difference was statistically significant; In the G2/M phase, the proportion of cells in the group KD was reduced compared with the group CON, the differ ence was statistically significant (P<0.001 byt-test analysis), but the proportion of cells in the group KD compared with the group NC were slightly increased, but the difference was not statistically significant(P>0.05 byt-test analysis). The results that the proportion of G0/G1phase cells was significantly increasing show in Fig.6. Such changes in the cell cycle distribution showed that AURKB gene induces cell cycle or mitotic arrest at G0/G1phase, which may play a role in chromosome segregation, in HCT 116 cells and downregulation of AURKB following transfection with AURKB specific siRNA may disrupt cell cycle control, decreasing cancer development. The gene is involved in G1/S phase transition by activating checkpoint control or regulation. It inhibits cell-cycle progression and counteracts the mitogenic activity of the AURKB gene.

3.6 Effects of AURKB on cell proliferation, apoptosis in HCT 116 cellsTo further investigate the effects of AURKB on cell apoptosis and further elucidate the apoptotic role of AURKB gene in CRC, we performed the caspase 3/7 activation assay. Results are shown in Fig.7. The cells of group KD were significantly inhibited cell growth in HCT 116 cells. Our results showed that compared with the group CON and the group NC, respectively, the activity of caspase 3/7 in group KD was analyzed byt-test (P<0.05). Collectively, the findings demonstrated that knockdown AURKB gene reduced cell viability, promoted cell apoptosis, and increased caspase 3/7 activity in CRC cell.

Notes: In HCT 116 cells, the results showed that compared with the negative group CON and the group NC, the activity of caspase 3/7 in the group KD was analyzed byt-test (P<0.05).

Fig.7 Apoptotic activity by caspase 3/7 activity assay

Notes: A. Green fluorescence observed with deferent group colonies cells. colonies appearing on the plate were visualized under a normal fluorescent lamp. Bright field and green fluorescent field images (original magnification: 100×) of the colony formation of the HCT 116 cells. B. HCT 116 cell clones, after fixation and crystal violet staining, the experimental groups formed controllable contrast the colony formation of the HCT 116 cells in each group. C. Quantitative data analysis of the effects of knockdown AURKB on the colony formation of the cells. The results indicated that lower expression of group KD significantly diminished the colony formation rates of HCT 116 cells compared with the group CON and the group NC, respectively. B and G represent bright field and green fluorescent field, respectively; KD: group HCT 116 cells with AURKB specific small interfering RNA (siRNA) lentiviral vectors; NC: group HCT 116 cells with AURKB negative control siRNA lentiviral vectors; CON: group HCT 116 cells without lentiviral infection. Data are presented as the mean±SD and experiments were performed in three replicates.*P<0.05 compared with CON and**P<0.05 compared with NC.

Fig.8 Colon of HCT 116 cell line

3.7 AURKB downregulation significantly impeding the proliferation of HCT 116 cellsTo confirm the survival rate of cells, a colony assay was performed in the HCT 116 cells with various interventions as described previously. Colony formation is considered a key characteristic of cancer cells and is commonly usedinvitrocancer research. The ability of the cells to proliferate is indicated by the ability of the cells to form clones on the cell culture plates after infection. Clonal formation is one of the effective methods for determining cell proliferation ability. The results of the colony formation assay showed that the colony formation efficiency in group KD was significantly reduced compared with group CON and group NC, (t-test,P<0.05), respectively. As shown in Fig.8, there was no significant difference between the negative group CON and the group NC. These results suggested that the AURKB gene silencing inhibited the colony formation of the colorectal tumor cells and AURKB downregulation significantly impeded the proliferation of HCT 116.

4 Conclusions and discussions

CRC is the third most common cancer in the world and the fourth most common cause of cancer-related deaths[16-17]. Seeking new treatments for CRC targets is under intense investigation as a novel therapeutic approach against CRC. Aurora kinases, consisting of three family members (Aurora kinase A, B, C), are one of the serine-threonine kinases and involved in multiple mitotic events[18]. Aurora kinase B (AURKB) is a gene that encodes a protein that is a member of the aurora kinase serine/threonine kinase family. The protein functions in the process of chromosomal segregation during mitosis and meiosis. Overexpression of AURKB causes unequal distribution of genetic information, creating aneuploidy cells, a hallmark of cancer.

Cell culture studies with targeted downregulation of AURKB gene expression and studies utilizing knockdown HCT 116 cells were transfected with Lentivirus have helped to elucidate the potential roles of individual AURKB gene in this malignancy. AURKB gene, for which strong links to development or progression of CRC, may be potential future targets for clinical interventions.

To fully understand the role of AURKB, we conducted this study in HCT 116 cells. In this study, AURKB gene is widely expressed in CRC. The elucidation of apoptosis function in the invitro via cell with virus infection, cell viability, apoptosis, and caspase 3/7 activation analyses revealed significant reduction of cell viability and promotion of cell apoptosis following knockdown AURKB with AURKB specific siRNA lentivirus transfection. We found knockdown AURKB can effectively reduce AURKB expression, thereby inhibiting cell proliferation and community formation of HCT 116 cells. AURKB is, therefore, a potentially novel effector of inducing CRC cells apoptosis, thus, a promising target to ameliorate CRC.

Chong Wang team’s study[19]showed that the tumor suppressive effect of AURKB is due to the induction of cell cycle arrest and/or apoptosis and AURKB regulates cell survival and proliferation in lymphoma via activating AKT/mTOR signaling pathway. Apoptosis, called programmed cell death (PCD), is a biological process with a crucial role in normal development and tissue homeostasis[20]. Apoptosis is one of the two distinct processes, regulating cell survival and cell death, and occur simultaneously in cancers[21-22]. Apoptosis is involved in the metabolism of CRC and plays an important role in the multifactorial etiology of CRC. So, focusing on the modulation of apoptosis has enabled the identification of potential new therapeutic strategies for the treatment of colon cancer[23]. Decreased cell proliferation induced by AURKB knockdown may be a consequence of increased cell death. Thus, we analyzed the apoptosis in HCT 116 cells. We found that the cells of group KD had higher percentages of apoptotic cell number compared with the group CON and the group NC (Fig.5). Consistently, the apoptosis and caspase 3/7 activity was both enhanced in the cells of group KD compared with the group CON and the group NC, respectively. AURKB can become a target set on treating CRC.

Further experiments confirmed that knockdown AURKB can cause cell cycle arrest in the G0/G1phase, resulting in inhibition of cell growth. Thus, AURKB acts as an inhibitor of apoptosis induced by interfering cell mitosis and meiosis. Mitosis controlling the mother cells to divide into two daughter cells with equal chromosomes and cytoplasm is accurately by a series of serine/threonine kinases in cell cycle, and among which Aurora kinases are important and indispensable in multiple steps of mitotic progression. Loss of AURKB activity could override spindle assembly checkpoint (SAC) through premature removal of SAC proteins from the kinetochore[24], which leads to defect of chromosome segregation and conformation of polyploidy. AURKB decreases the expression of the cell cycle inhibitor p21WAF1/CIP1 via suppressing p53 activity[25], resulting in aberrant activation of Cyclin-dependent kinase 1, leading to cell cycle progression and thereby promoting cell survival. Our findings supported our hypothesis whereby AURKB gene could regulate proliferation and apoptosis by interfered cell mitosis.

In conclusion, we found that AURKB plays an important role in CRC cell proliferation and community formation. Our study provides strong evidence that AURKB is a potential therapeutic target for the treatment of CRC in humans. Lentiviral-mediated AURKB silencing is a promising approach to gene therapy for CRC. KRAS mutations represent the most common oncogene driver[24]. Edmilson’s study showed that Aurora kinases are important KRAS targets in lung cancer and suggest aurora kinase inhibition as a novel approach for KRAS-induced lung cancer therapy. Furthermore, our study provides a rationale to further validate whether the expression levels of AURKB in human colorectal cells may serve as therapeutic markers for the application of daurinol and other aurora kinases inhibitors along with treatment for CRC. Whether having KRAS mutations in CRC and AURKB can be as the KRAS targets in CRC. Some plants, such as fungi, can inhibit threonine/serine and affect the role of AURKB. Our experiments provide new targets and theoretical basis for the development of botanicals.